Human TPI1/HEL-S-49/TIM ORF/cDNA clone-Lentivirus plasmid (NM_000365)

Cat. No.: pGMLP003331
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TPI1/HEL-S-49/TIM Lentiviral expression plasmid for TPI1 lentivirus packaging, TPI1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TPI1/HEL-S-49 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $487.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003331
Gene Name TPI1
Accession Number NM_000365
Gene ID 7167
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 750 bp
Gene Alias HEL-S-49,TIM,TPI,TPID
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCCCTCCAGGAAGTTCTTCGTTGGGGGAAACTGGAAGATGAACGGGCGGAAGCAGAGTCTGGGGGAGCTCATCGGCACTCTGAACGCGGCCAAGGTGCCGGCCGACACCGAGGTGGTTTGTGCTCCCCCTACTGCCTATATCGACTTCGCCCGGCAGAAGCTAGATCCCAAGATTGCTGTGGCTGCGCAGAACTGCTACAAAGTGACTAATGGGGCTTTTACTGGGGAGATCAGCCCTGGCATGATCAAAGACTGCGGAGCCACGTGGGTGGTCCTGGGGCACTCAGAGAGAAGGCATGTCTTTGGGGAGTCAGATGAGCTGATTGGGCAGAAAGTGGCCCATGCTCTGGCAGAGGGACTCGGAGTAATCGCCTGCATTGGGGAGAAGCTAGATGAAAGGGAAGCTGGCATCACTGAGAAGGTTGTTTTCGAGCAGACAAAGGTCATCGCAGATAACGTGAAGGACTGGAGCAAGGTCGTCCTGGCCTATGAGCCTGTGTGGGCCATTGGTACTGGCAAGACTGCAACACCCCAACAGGCCCAGGAAGTACACGAGAAGCTCCGAGGATGGCTGAAGTCCAACGTCTCTGATGCGGTGGCTCAGAGCACCCGTATCATTTATGGAGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATGTGGATGGCTTCCTTGTGGGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCAATGCCAAACAATGA
ORF Protein Sequence MAPSRKFFVGGNWKMNGRKQSLGELIGTLNAAKVPADTEVVCAPPTAYIDFARQKLDPKIAVAAQNCYKVTNGAFTGEISPGMIKDCGATWVVLGHSERRHVFGESDELIGQKVAHALAEGLGVIACIGEKLDEREAGITEKVVFEQTKVIADNVKDWSKVVLAYEPVWAIGTGKTATPQQAQEVHEKLRGWLKSNVSDAVAQSTRIIYGGSVTGATCKELASQPDVDGFLVGGASLKPEFVDIINAKQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2166-Ab Anti-TPI1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2166-Ag TPI1 protein
    ORF Viral Vector pGMLP003331 Human TPI1 Lentivirus plasmid
    ORF Viral Vector pGMLV000924 Human TPI1 Lentivirus plasmid
    ORF Viral Vector pGMPC000222 Human TPI1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003331 Human TPI1 Lentivirus particle
    ORF Viral Vector vGMLV000924 Human TPI1 Lentivirus particle


    Target information

    Target ID GM-IP2166
    Target Name TPI1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    7167
    Gene ID 100052671 (Equus caballus), 101085900 (Felis catus), 21991 (Mus musculus), 24849 (Rattus norvegicus)
    281543 (Bos taurus), 477711 (Canis lupus familiaris), 714090 (Macaca mulatta), 7167 (Homo sapiens)
    Gene Symbols & Synonyms TPI1,Tpi1,TIM,Tpi,Tpi-1,tpi,TPI,TPID,HEL-S-49
    Target Alternative Names HEL-S-49,Methylglyoxal synthase,TIM,TPI,TPI1,TPID,Tpi,Tpi-1,Tpi1,Triose-phosphate isomerase,Triosephosphate isomerase,tpi
    Uniprot Accession P15426,P17751,P48500,P54714,P60174,Q5E956
    Additional SwissProt Accessions: P17751,P48500,Q5E956,P54714,P15426,P60174
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease Malignant neoplasm of bladder, Congenital occlusion of ureteropelvic junction
    Disease from KEGG Metabolic pathways
    Gene Ensembl ENSECAG00000015581, ENSMUSG00000023456, ENSBTAG00000019782, ENSCAFG00845027022, ENSMMUG00000052852, ENSG00000111669
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.