Human LPAR2/EDG-4/EDG4 ORF/cDNA clone-Lentivirus plasmid (NM_004720)

Cat. No.: pGMLP003145
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LPAR2/EDG-4/EDG4 Lentiviral expression plasmid for LPAR2 lentivirus packaging, LPAR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LPAR2/EDG-4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $595.68
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003145
Gene Name LPAR2
Accession Number NM_004720
Gene ID 9170
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1056 bp
Gene Alias EDG-4,EDG4,LPA-2,LPA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTCATCATGGGCCAGTGCTACTACAACGAGACCATCGGCTTCTTCTATAACAACAGTGGCAAAGAGCTCAGCTCCCACTGGCGGCCCAAGGATGTGGTCGTGGTGGCACTGGGGCTGACCGTCAGCGTGCTGGTGCTGCTGACCAATCTGCTGGTCATAGCAGCCATCGCCTCCAACCGCCGCTTCCACCAGCCCATCTACTACCTGCTCGGCAATCTGGCCGCGGCTGACCTCTTCGCGGGCGTGGCCTACCTCTTCCTCATGTTCCACACTGGTCCCCGCACAGCCCGACTTTCACTTGAGGGCTGGTTCCTGCGGCAGGGCTTGCTGGACACAAGCCTCACTGCGTCGGTGGCCACACTGCTGGCCATCGCCGTGGAGCGGCACCGCAGTGTGATGGCCGTGCAGCTGCACAGCCGCCTGCCCCGTGGCCGCGTGGTCATGCTCATTGTGGGCGTGTGGGTGGCTGCCCTGGGCCTGGGGCTGCTGCCTGCCCACTCCTGGCACTGCCTCTGTGCCCTGGACCGCTGCTCACGCATGGCACCCCTGCTCAGCCGCTCCTATTTGGCCGTCTGGGCTCTGTCGAGCCTGCTTGTCTTCCTGCTCATGGTGGCTGTGTACACCCGCATTTTCTTCTACGTGCGGCGGCGAGTGCAGCGCATGGCAGAGCATGTCAGCTGCCACCCCCGCTACCGAGAGACCACGCTCAGCCTGGTCAAGACTGTTGTCATCATCCTGGGGGCGTTCGTGGTCTGCTGGACACCAGGCCAGGTGGTACTGCTCCTGGATGGTTTAGGCTGTGAGTCCTGCAATGTCCTGGCTGTAGAAAAGTACTTCCTACTGTTGGCCGAGGCCAACTCCCTGGTCAATGCTGCTGTGTACTCTTGCCGAGATGCTGAGATGCGCCGCACCTTCCGCCGCCTTCTCTGCTGCGCGTGCCTCCGCCAGTCCACCCGCGAGTCTGTCCACTATACATCCTCTGCCCAGGGAGGTGCCAGCACTCGCATCATGCTTCCCGAGAACGGCCACCCACTGATGGACTCCACCCTTTAG
ORF Protein Sequence MVIMGQCYYNETIGFFYNNSGKELSSHWRPKDVVVVALGLTVSVLVLLTNLLVIAAIASNRRFHQPIYYLLGNLAAADLFAGVAYLFLMFHTGPRTARLSLEGWFLRQGLLDTSLTASVATLLAIAVERHRSVMAVQLHSRLPRGRVVMLIVGVWVAALGLGLLPAHSWHCLCALDRCSRMAPLLSRSYLAVWALSSLLVFLLMVAVYTRIFFYVRRRVQRMAEHVSCHPRYRETTLSLVKTVVIILGAFVVCWTPGQVVLLLDGLGCESCNVLAVEKYFLLLAEANSLVNAAVYSCRDAEMRRTFRRLLCCACLRQSTRESVHYTSSAQGGASTRIMLPENGHPLMDSTL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39380-Ab Anti-LPAR2/ EDG-4/ EDG4 monoclonal antibody
    Target Antigen GM-Tg-g-T39380-Ag LPAR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003145 Human LPAR2 Lentivirus plasmid
    ORF Viral Vector pGMLV000233 Human LPAR2 Lentivirus plasmid
    ORF Viral Vector vGMLP003145 Human LPAR2 Lentivirus particle
    ORF Viral Vector vGMLV000233 Human LPAR2 Lentivirus particle


    Target information

    Target ID GM-T39380
    Target Name LPAR2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    9170
    Gene ID 101100950 (Felis catus), 138915000 (Equus caballus), 484802 (Canis lupus familiaris), 498609 (Rattus norvegicus)
    509748 (Bos taurus), 53978 (Mus musculus), 719844 (Macaca mulatta), 9170 (Homo sapiens)
    Gene Symbols & Synonyms LPAR2,LOC138915000,Lpar2,EDG4,Edg4,RGD1561336,IPA2,LPA2,EDG-4,LPA-2
    Target Alternative Names EDG-4,EDG4,Edg4,IPA2,LOC138915000,LPA receptor 2,LPA-2,LPA2,LPAR2,Lpar2,Lysophosphatidic acid receptor 2,Lysophosphatidic acid receptor Edg-4,RGD1561336
    Uniprot Accession Q9HBW0,Q9JL06
    Additional SwissProt Accessions: Q9JL06,Q9HBW0
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Rap1 signaling pathway, Phospholipase D signaling pathway, Neuroactive ligand-receptor interaction, PI3K-Akt signaling pathway, Regulation of actin cytoskeleton, Pathogenic Escherichia coli infection, Pathways in cancer
    Gene Ensembl ENSCAFG00845014191, ENSBTAG00000004652, ENSMUSG00000031861, ENSMMUG00000000654, ENSG00000064547
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.