Human RAB25/CATX-8/RAB11C ORF/cDNA clone-Lentivirus plasmid (NM_020387)

Cat. No.: pGMLP003138
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RAB25/CATX-8/RAB11C Lentiviral expression plasmid for RAB25 lentivirus packaging, RAB25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to RAB25/CATX-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $460.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003138
Gene Name RAB25
Accession Number NM_020387
Gene ID 57111
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 642 bp
Gene Alias CATX-8,RAB11C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAATGGAACTGAGGAAGATTATAACTTTGTCTTCAAGGTGGTGCTGATCGGCGAATCAGGTGTGGGGAAGACCAATCTACTCTCCCGATTCACGCGCAATGAGTTCAGCCACGACAGCCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTGATGTTGGGCACCGCTGCTGTCAAGGCTCAGATCTGGGACACAGCTGGCCTGGAGCGGTACCGAGCCATCACCTCGGCGTACTATCGTGGTGCAGTGGGGGCCCTCCTGGTGTTTGACCTAACCAAGCACCAGACCTATGCTGTGGTGGAGCGATGGCTGAAGGAGCTCTATGACCATGCTGAAGCCACGATCGTCGTCATGCTCGTGGGTAACAAAAGTGACCTCAGCCAGGCCCGGGAAGTGCCCACTGAGGAGGCCCGAATGTTCGCTGAAAACAATGGACTGCTCTTCCTGGAGACCTCAGCCCTGGACTCTACCAATGTTGAGCTAGCCTTTGAGACTGTCCTGAAAGAAATCTTTGCGAAGGTGTCCAAGCAGAGACAGAACAGCATCCGGACCAATGCCATCACTCTGGGCAGTGCCCAGGCTGGACAGGAGCCTGGCCCTGGGGAGAAGAGGGCCTGTTGCATCAGCCTCTGA
ORF Protein Sequence MGNGTEEDYNFVFKVVLIGESGVGKTNLLSRFTRNEFSHDSRTTIGVEFSTRTVMLGTAAVKAQIWDTAGLERYRAITSAYYRGAVGALLVFDLTKHQTYAVVERWLKELYDHAEATIVVMLVGNKSDLSQAREVPTEEARMFAENNGLLFLETSALDSTNVELAFETVLKEIFAKVSKQRQNSIRTNAITLGSAQAGQEPGPGEKRACCISL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2686-Ab Anti-RAB25 monoclonal antibody
    Target Antigen GM-Tg-g-IP2686-Ag RAB25 protein
    ORF Viral Vector pGMLP003138 Human RAB25 Lentivirus plasmid
    ORF Viral Vector pGMLV000081 Human RAB25 Lentivirus plasmid
    ORF Viral Vector vGMLP003138 Human RAB25 Lentivirus particle
    ORF Viral Vector vGMLV000081 Human RAB25 Lentivirus particle


    Target information

    Target ID GM-IP2686
    Target Name RAB25
    Gene Group Identifier
    (Target Gene ID in Homo species)
    57111
    Gene ID 100057624 (Equus caballus), 101084416 (Felis catus), 310632 (Rattus norvegicus), 490418 (Canis lupus familiaris)
    506482 (Bos taurus), 53868 (Mus musculus), 57111 (Homo sapiens), 718131 (Macaca mulatta)
    Gene Symbols & Synonyms RAB25,Rab25,CATX-8,RAB11C
    Target Alternative Names CATX-8,RAB11C,RAB25,Rab25,Ras-related protein Rab-25
    Uniprot Accession E2RQ15,P57735,Q58DW6,Q9WTL2
    Additional SwissProt Accessions: E2RQ15,Q58DW6,Q9WTL2,P57735
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000023191, ENSCAFG00845010319, ENSBTAG00000018914, ENSMUSG00000008601, ENSG00000132698, ENSMMUG00000022306
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.