Human OPRD1/OPRD ORF/cDNA clone-Lentivirus plasmid (NM_000911)

Cat. No.: pGMLP002987
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human OPRD1/OPRD Lentiviral expression plasmid for OPRD1 lentivirus packaging, OPRD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to OPRD1/OPRD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $613.32
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002987
Gene Name OPRD1
Accession Number NM_000911
Gene ID 4985
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1119 bp
Gene Alias OPRD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAACCGGCCCCCTCCGCCGGCGCCGAGCTGCAGCCCCCGCTCTTCGCCAACGCCTCGGACGCCTACCCTAGCGCCTGCCCCAGCGCTGGCGCCAATGCGTCGGGGCCGCCAGGCGCGCGGAGCGCCTCGTCCCTCGCCCTGGCAATCGCCATCACCGCGCTCTACTCGGCCGTGTGCGCCGTGGGGCTGCTGGGCAACGTGCTTGTCATGTTCGGCATCGTCCGGTACACTAAGATGAAGACGGCCACCAACATCTACATCTTCAACCTGGCCTTAGCCGATGCGCTGGCCACCAGCACGCTGCCTTTCCAGAGTGCCAAGTACCTGATGGAGACGTGGCCCTTCGGCGAGCTGCTCTGCAAGGCTGTGCTCTCCATCGACTACTACAATATGTTCACCAGCATCTTCACGCTCACCATGATGAGTGTTGACCGCTACATCGCTGTCTGCCACCCTGTCAAGGCCCTGGACTTCCGCACGCCTGCCAAGGCCAAGCTGATCAACATCTGTATCTGGGTCCTGGCCTCAGGCGTTGGCGTGCCCATCATGGTCATGGCTGTGACCCGTCCCCGGGACGGGGCAGTGGTGTGCATGCTCCAGTTCCCCAGCCCCAGCTGGTACTGGGACACGGTGACCAAGATCTGCGTGTTCCTCTTCGCCTTCGTGGTGCCCATCCTCATCATCACCGTGTGCTATGGCCTCATGCTGCTGCGCCTGCGCAGTGTGCGCCTGCTGTCGGGCTCCAAGGAGAAGGACCGCAGCCTGCGGCGCATCACGCGCATGGTGCTGGTGGTTGTGGGCGCCTTCGTGGTGTGTTGGGCGCCCATCCACATCTTCGTCATCGTCTGGACGCTGGTGGACATCGACCGGCGCGACCCGCTGGTGGTGGCTGCGCTGCACCTGTGCATCGCGCTGGGCTACGCCAATAGCAGCCTCAACCCCGTGCTCTACGCTTTCCTCGACGAGAACTTCAAGCGCTGCTTCCGCCAGCTCTGCCGCAAGCCCTGCGGCCGCCCAGACCCCAGCAGCTTCAGCCGCGCCCGCGAAGCCACGGCCCGCGAGCGTGTCACCGCCTGCACCCCGTCCGATGGTCCCGGCGGTGGCGCTGCCGCCTGA
ORF Protein Sequence MEPAPSAGAELQPPLFANASDAYPSACPSAGANASGPPGARSASSLALAIAITALYSAVCAVGLLGNVLVMFGIVRYTKMKTATNIYIFNLALADALATSTLPFQSAKYLMETWPFGELLCKAVLSIDYYNMFTSIFTLTMMSVDRYIAVCHPVKALDFRTPAKAKLINICIWVLASGVGVPIMVMAVTRPRDGAVVCMLQFPSPSWYWDTVTKICVFLFAFVVPILIITVCYGLMLLRLRSVRLLSGSKEKDRSLRRITRMVLVVVGAFVVCWAPIHIFVIVWTLVDIDRRDPLVVAALHLCIALGYANSSLNPVLYAFLDENFKRCFRQLCRKPCGRPDPSSFSRAREATARERVTACTPSDGPGGGAAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58992-Ab Anti-OPRD/ OPRD1/ DOP monoclonal antibody
    Target Antigen GM-Tg-g-T58992-Ag OPRD1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002987 Human OPRD1 Lentivirus plasmid
    ORF Viral Vector vGMLP002987 Human OPRD1 Lentivirus particle


    Target information

    Target ID GM-T58992
    Target Name OPRD1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		4985
    Gene ID 100070646 (Equus caballus), 101088861 (Felis catus), 18386 (Mus musculus), 24613 (Rattus norvegicus)
    487329 (Canis lupus familiaris), 4985 (Homo sapiens), 717256 (Macaca mulatta), 781956 (Bos taurus)
    Gene Symbols & Synonyms OPRD1,Oprd1,DOR,Nbor,mDOR,DOR-1,DOP,DOR1,OPRD
    Target Alternative Names D-OR-1,DOP,DOR,DOR-1,DOR1,Delta-type opioid receptor,Nbor,OPRD,OPRD1,Oprd1,mDOR
    Uniprot Accession P32300,P33533,P41143
    Additional SwissProt Accessions: P32300,P33533,P41143
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG cGMP-PKG signaling pathway, Sphingolipid signaling pathway, Neuroactive ligand-receptor interaction
    Gene Ensembl ENSMUSG00000050511, ENSCAFG00845009543, ENSG00000116329, ENSMMUG00000011391, ENSBTAG00000003202
    Target Classification GPCR


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.