Human IL2RA/CD25/IDDM10 ORF/cDNA clone-Lentivirus plasmid (NM_000417)

Cat. No.: pGMLP002911
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL2RA/CD25/IDDM10 Lentiviral expression plasmid for IL2RA lentivirus packaging, IL2RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD25/IL-2RA/IL2RA/IL2RA/CD25 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $504.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002911
Gene Name IL2RA
Accession Number NM_000417
Gene ID 3559
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 819 bp
Gene Alias CD25,IDDM10,IL2R,IMD41,p55,TCGFR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATTCATACCTGCTGATGTGGGGACTGCTCACGTTCATCATGGTGCCTGGCTGCCAGGCAGAGCTCTGTGACGATGACCCGCCAGAGATCCCACACGCCACATTCAAAGCCATGGCCTACAAGGAAGGAACCATGTTGAACTGTGAATGCAAGAGAGGTTTCCGCAGAATAAAAAGCGGGTCACTCTATATGCTCTGTACAGGAAACTCTAGCCACTCGTCCTGGGACAACCAATGTCAATGCACAAGCTCTGCCACTCGGAACACAACGAAACAAGTGACACCTCAACCTGAAGAACAGAAAGAAAGGAAAACCACAGAAATGCAAAGTCCAATGCAGCCAGTGGACCAAGCGAGCCTTCCAGGTCACTGCAGGGAACCTCCACCATGGGAAAATGAAGCCACAGAGAGAATTTATCATTTCGTGGTGGGGCAGATGGTTTATTATCAGTGCGTCCAGGGATACAGGGCTCTACACAGAGGTCCTGCTGAGAGCGTCTGCAAAATGACCCACGGGAAGACAAGGTGGACCCAGCCCCAGCTCATATGCACAGGTGAAATGGAGACCAGTCAGTTTCCAGGTGAAGAGAAGCCTCAGGCAAGCCCCGAAGGCCGTCCTGAGAGTGAGACTTCCTGCCTCGTCACAACAACAGATTTTCAAATACAGACAGAAATGGCTGCAACCATGGAGACGTCCATATTTACAACAGAGTACCAGGTAGCAGTGGCCGGCTGTGTTTTCCTGCTGATCAGCGTCCTCCTCCTGAGTGGGCTCACCTGGCAGCGGAGACAGAGGAAGAGTAGAAGAACAATCTAG
ORF Protein Sequence MDSYLLMWGLLTFIMVPGCQAELCDDDPPEIPHATFKAMAYKEGTMLNCECKRGFRRIKSGSLYMLCTGNSSHSSWDNQCQCTSSATRNTTKQVTPQPEEQKERKTTEMQSPMQPVDQASLPGHCREPPPWENEATERIYHFVVGQMVYYQCVQGYRALHRGPAESVCKMTHGKTRWTQPQLICTGEMETSQFPGEEKPQASPEGRPESETSCLVTTTDFQIQTEMAATMETSIFTTEYQVAVAGCVFLLISVLLLSGLTWQRRQRKSRRTI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-907 Pre-Made Melredableukin Alfa Biosimilar, Fusion Protein targeting IL2RA fused with human IL2 (interleukin 2, IL-2) via a peptidyl linker: Recombinant therapeutic protein targeting CD25/IDDM10/IL2R/IMD41/TCGFR/p55
    Biosimilar GMP-Bios-INN-926 Pre-Made Nemvaleukin Alfa Biosimilar, Fusion Protein targeting IL2RA fused with human IL2RA (interleukin 2 receptor alpha subunit, IL-2RA, TAC, p55, CD25) 139-303 (1-165): Recombinant therapeutic protein targeting CD25/IDDM10/IL2R/IMD41/TCGFR/p55
    Biosimilar GMP-Bios-INN-768 Pre-Made Camidanlumab Tesirine Biosimilar, Whole Mab Adc, Anti-Il2Ra Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-INN-789 Pre-Made Daclizumab Beta Biosimilar, Whole Mab, Anti-Il2Ra Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-ab-129 Pre-Made Daclizumab biosimilar, Whole mAb, Anti-IL2RA Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-ab-049 Pre-Made Basiliximab biosimilar, Whole mAb, Anti-IL2RA Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-INN-867 Pre-Made Inolimomab Biosimilar, Whole Mab, Anti-Il2Ra Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-ab-089 Pre-Made Camidanlumab biosimilar, Whole mAb ADC, Anti-IL2RA Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Target Antibody GM-Tg-g-T03313-Ab Anti-IL2RA/ CD25/ IDDM10 monoclonal antibody
    Target Antigen GM-Tg-g-T03313-Ag IL2RA VLP (virus-like particle)
    ORF Viral Vector pGMLP002911 Human IL2RA Lentivirus plasmid
    ORF Viral Vector vGMLP002911 Human IL2RA Lentivirus particle


    Target information

    Target ID GM-T03313
    Target Name CD25/IL-2RA/IL2RA
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3559
    Gene ID 100070292 (Equus caballus), 16184 (Mus musculus), 25704 (Rattus norvegicus), 281861 (Bos taurus)
    3559 (Homo sapiens), 403870 (Canis lupus familiaris), 493953 (Felis catus), 574300 (Macaca mulatta)
    Gene Symbols & Synonyms IL2RA,Il2ra,CD25,Il2r,Ly-43,IL2RAC,p55,IL2R,IMD41,TCGFR,IDDM10,IL-2RA
    Target Alternative Names CD25,IDDM10,IL-2 receptor subunit alpha,IL-2-RA,IL-2R subunit alpha,IL-2RA,IL2-RA,IL2R,IL2RA,IL2RAC,IMD41,Il2r,Il2ra,Interleukin-2 receptor subunit alpha,Ly-43,TAC antigen,TCGFR,p55
    Uniprot Accession O62802,P01589,P01590,P12342,P26897,P41690,Q5MNY4
    Additional SwissProt Accessions: P01590,P26897,P12342,P01589,O62802,P41690,Q5MNY4
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease cancer, Ovary Cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, PI3K-Akt signaling pathway, JAK-STAT signaling pathway, Hematopoietic cell lineage, Th1 and Th2 cell differentiation, Th17 cell differentiation, Measles, Human T-cell leukemia virus 1 infection, Pathways in cancer
    Gene Ensembl ENSECAG00000018057, ENSMUSG00000026770, ENSBTAG00000020892, ENSG00000134460, ENSCAFG00845002030, ENSMMUG00000015151
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.