Human TNNI3/CMD1FF/CMD2A ORF/cDNA clone-Lentivirus plasmid (NM_000363)

Cat. No.: pGMLP002894
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TNNI3/CMD1FF/CMD2A Lentiviral expression plasmid for TNNI3 lentivirus packaging, TNNI3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Cardiac Troponin I/TNNI3/TNNI3/CMD1FF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $458.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002894
Gene Name TNNI3
Accession Number NM_000363
Gene ID 7137
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 633 bp
Gene Alias CMD1FF,CMD2A,CMH7,cTnI,RCM1,TNNC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGATGGGAGCAGCGATGCGGCTAGGGAACCTCGCCCTGCACCAGCCCCAATCAGACGCCGCTCCTCCAACTACCGCGCTTATGCCACGGAGCCGCACGCCAAGAAAAAATCTAAGATCTCCGCCTCGAGAAAATTGCAGCTGAAGACTCTGCTGCTGCAGATTGCAAAGCAAGAGCTGGAGCGAGAGGCGGAGGAGCGGCGCGGAGAGAAGGGGCGCGCTCTGAGCACCCGCTGCCAGCCGCTGGAGTTGGCCGGGCTGGGCTTCGCGGAGCTGCAGGACTTGTGCCGACAGCTCCACGCCCGTGTGGACAAGGTGGATGAAGAGAGATACGACATAGAGGCAAAAGTCACCAAGAACATCACGGAGATTGCAGATCTGACTCAGAAGATCTTTGACCTTCGAGGCAAGTTTAAGCGGCCCACCCTGCGGAGAGTGAGGATCTCTGCAGATGCCATGATGCAGGCGCTGCTGGGGGCCCGGGCTAAGGAGTCCCTGGACCTGCGGGCCCACCTCAAGCAGGTGAAGAAGGAGGACACCGAGAAGGAAAACCGGGAGGTGGGAGACTGGCGCAAGAACATCGATGCACTGAGTGGAATGGAGGGCCGCAAGAAAAAGTTTGAGAGCTGA
ORF Protein Sequence MADGSSDAAREPRPAPAPIRRRSSNYRAYATEPHAKKKSKISASRKLQLKTLLLQIAKQELEREAEERRGEKGRALSTRCQPLELAGLGFAELQDLCRQLHARVDKVDEERYDIEAKVTKNITEIADLTQKIFDLRGKFKRPTLRRVRISADAMMQALLGARAKESLDLRAHLKQVKKEDTEKENREVGDWRKNIDALSGMEGRKKKFES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20186-Ab Anti-TNNI3 monoclonal antibody
    Target Antigen GM-Tg-g-T20186-Ag TNNI3 protein
    ORF Viral Vector pGMLP002894 Human TNNI3 Lentivirus plasmid
    ORF Viral Vector vGMLP002894 Human TNNI3 Lentivirus particle


    Target information

    Target ID GM-T20186
    Target Name Cardiac Troponin I/TNNI3
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7137
    Gene ID 100034065 (Equus caballus), 21954 (Mus musculus), 29248 (Rattus norvegicus), 403566 (Canis lupus familiaris)
    493744 (Felis catus), 511094 (Bos taurus), 698470 (Macaca mulatta), 7137 (Homo sapiens)
    Gene Symbols & Synonyms TNNI3,Tnni3,Tn1,cTnI,TnI,cTNI,CMH7,RCM1,CMD2A,TNNC1,CMD1FF
    Target Alternative Names CMD1FF,CMD2A,CMH7,Cardiac Troponin I,Cardiac troponin I,RCM1,TNNC1,TNNI3,Tn1,TnI,Tnni3,Troponin I,cTNI,cTnI,cardiac muscle
    Uniprot Accession P08057,P19429,P23693,P48787,Q5PYI0,Q863B6,Q8MKD5
    Additional SwissProt Accessions: Q5PYI0,P48787,P23693,Q8MKD5,Q863B6,P08057,P19429
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease
    Disease from KEGG cAMP signaling pathway, Adrenergic signaling in cardiomyocytes, Hypertrophic cardiomyopathy, Dilated cardiomyopathy
    Gene Ensembl ENSECAG00000017232, ENSMUSG00000035458, ENSBTAG00000002515, ENSG00000129991
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.