Human TREX1/AGS1/CRV ORF/cDNA clone-Lentivirus plasmid (NM_033629)

Cat. No.: pGMLP002828
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TREX1/AGS1/CRV Lentiviral expression plasmid for TREX1 lentivirus packaging, TREX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TREX1/AGS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $536.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002828
Gene Name TREX1
Accession Number NM_033629
Gene ID 11277
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 945 bp
Gene Alias AGS1,CRV,DRN3,HERNS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCTCGCAGGCCCTGCCCCCGGGGCCCATGCAGACCCTCATCTTTTTCGACATGGAGGCCACTGGCTTGCCCTTCTCCCAGCCCAAGGTCACGGAGCTGTGCCTGCTGGCTGTCCACAGATGTGCCCTGGAGAGCCCCCCCACCTCTCAGGGGCCACCTCCCACAGTTCCTCCACCACCGCGTGTGGTAGACAAGCTCTCCCTGTGTGTGGCTCCGGGGAAGGCCTGCAGCCCTGCAGCCAGCGAGATCACAGGTCTGAGCACAGCTGTGCTGGCAGCGCATGGGCGTCAATGTTTTGATGACAACCTGGCCAACCTGCTCCTAGCCTTCCTGCGGCGCCAGCCACAGCCCTGGTGCCTGGTGGCACACAATGGTGACCGCTACGACTTCCCCCTGCTCCAAGCAGAGCTGGCTATGCTGGGCCTCACCAGTGCTCTGGATGGTGCCTTCTGTGTGGATAGCATCACTGCGCTGAAGGCCCTGGAGCGAGCAAGCAGCCCCTCAGAACACGGCCCAAGGAAGAGCTATAGCCTAGGCAGCATCTACACTCGCCTGTATGGGCAGTCCCCTCCAGACTCGCACACGGCTGAGGGTGATGTCCTGGCCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGCTCACGCCAGGCCTTTCGGCACCATCAGGCCCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGCACACCTGGCCACAACCAGGAACACTAGTCCCAGCCTTGGAGAGAGCAGGGGTACCAAGGATCTTCCTCCAGTGAAGGACCCTGGAGCCCTATCCAGGGAGGGGCTGCTGGCCCCACTGGGTCTGCTGGCCATCCTGACCTTGGCAGTAGCCACACTGTATGGACTATCCCTGGCCACACCTGGGGAGTAG
ORF Protein Sequence MGSQALPPGPMQTLIFFDMEATGLPFSQPKVTELCLLAVHRCALESPPTSQGPPPTVPPPPRVVDKLSLCVAPGKACSPAASEITGLSTAVLAAHGRQCFDDNLANLLLAFLRRQPQPWCLVAHNGDRYDFPLLQAELAMLGLTSALDGAFCVDSITALKALERASSPSEHGPRKSYSLGSIYTRLYGQSPPDSHTAEGDVLALLSICQWRPQALLRWVDAHARPFGTIRPMYGVTASARTKPRPSAVTTTAHLATTRNTSPSLGESRGTKDLPPVKDPGALSREGLLAPLGLLAILTLAVATLYGLSLATPGE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2174-Ab Anti-TREX1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2174-Ag TREX1 protein
    ORF Viral Vector pGMLP002828 Human TREX1 Lentivirus plasmid
    ORF Viral Vector vGMLP002828 Human TREX1 Lentivirus particle


    Target information

    Target ID GM-IP2174
    Target Name TREX1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    11277
    Gene ID 100049583 (Rattus norvegicus), 100063767 (Equus caballus), 100429168 (Macaca mulatta), 101098935 (Felis catus)
    102155466 (Canis lupus familiaris), 11277 (Homo sapiens), 22040 (Mus musculus), 282099 (Bos taurus)
    Gene Symbols & Synonyms Trex1,TREX1,RGD1309596,CRV,AGS1,DRN3,HERNS,RVCLS
    Target Alternative Names 3'-5' exonuclease TREX1,AGS1,CRV,DRN3,Deoxyribonuclease III (DNase III),HERNS,RGD1309596,RVCLS,TREX1,Three-prime repair exonuclease 1,Trex1
    Uniprot Accession Q91XB0,Q9BG99,Q9NSU2
    Additional SwissProt Accessions: Q9NSU2,Q91XB0,Q9BG99
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease Pregnant state
    Disease from KEGG
    Gene Ensembl ENSMMUG00000043955, ENSCAFG00845006258, ENSG00000213689, ENSMUSG00000049734
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.