Human IL27/IL-27/IL-27A ORF/cDNA clone-Lentivirus plasmid (NM_145659)
Cat. No.: pGMLP002772
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IL27/IL-27/IL-27A Lentiviral expression plasmid for IL27 lentivirus packaging, IL27 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IL-27/IL-27A/IL27/IL27/IL-27 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP002772 |
| Gene Name | IL27 |
| Accession Number | NM_145659 |
| Gene ID | 246778 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 732 bp |
| Gene Alias | IL-27,IL-27A,IL27A,IL27p28,IL30,p28 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGCCAGACGGCAGGCGACCTTGGCTGGCGGCTCAGCCTGTTGCTGCTTCCCTTGCTCCTGGTTCAAGCTGGTGTCTGGGGATTCCCAAGGCCCCCAGGGAGGCCCCAGCTGAGCCTGCAGGAGCTGCGGAGGGAGTTCACAGTCAGCCTGCATCTCGCCAGGAAGCTGCTCTCCGAGGTTCGGGGCCAGGCCCACCGCTTTGCGGAATCTCACCTGCCAGGAGTGAACCTGTACCTCCTGCCCCTGGGAGAGCAGCTCCCTGATGTTTCCCTGACCTTCCAGGCCTGGCGCCGCCTCTCTGACCCGGAGCGTCTCTGCTTCATCTCCACCACGCTTCAGCCCTTCCATGCCCTGCTGGGAGGGCTGGGGACCCAGGGCCGCTGGACCAACATGGAGAGGATGCAGCTGTGGGCCATGAGGCTGGACCTCCGCGATCTGCAGCGGCACCTCCGCTTCCAGGTGCTGGCTGCAGGATTCAACCTCCCGGAGGAGGAGGAGGAGGAAGAGGAGGAGGAGGAGGAGGAGAGGAAGGGGCTGCTCCCAGGGGCACTGGGCAGCGCCTTACAGGGCCCGGCCCAGGTGTCCTGGCCCCAGCTCCTCTCCACCTACCGCCTGCTGCACTCCTTGGAGCTCGTCTTATCTCGGGCCGTGCGGGAGTTGCTGCTGCTGTCCAAGGCTGGGCACTCAGTCTGGCCCTTGGGGTTCCCAACATTGAGCCCCCAGCCCTGA |
| ORF Protein Sequence | MGQTAGDLGWRLSLLLLPLLLVQAGVWGFPRPPGRPQLSLQELRREFTVSLHLARKLLSEVRGQAHRFAESHLPGVNLYLLPLGEQLPDVSLTFQAWRRLSDPERLCFISTTLQPFHALLGGLGTQGRWTNMERMQLWAMRLDLRDLQRHLRFQVLAAGFNLPEEEEEEEEEEEEERKGLLPGALGSALQGPAQVSWPQLLSTYRLLHSLELVLSRAVRELLLLSKAGHSVWPLGFPTLSPQP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1026-Ab | Anti-IL27A/ IL27/ IL-27 functional antibody |
| Target Antigen | GM-Tg-g-SE1026-Ag | IL27 protein |
| ORF Viral Vector | pGMLP002772 | Human IL27 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-IL-034 | Human IL27 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-117 | Human IL27 Adenovirus plasmid |
| ORF Viral Vector | vGMLP002772 | Human IL27 Lentivirus particle |
| ORF Viral Vector | vGMLP-IL-034 | Human IL27 Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-117 | Human IL27 Adenovirus particle |
Target information
| Target ID | GM-SE1026 |
| Target Name | IL-27/IL-27A/IL27 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
246778 |
| Gene ID |
100066317 (Equus caballus), 101093822 (Felis catus), 246778 (Homo sapiens), 246779 (Mus musculus) 365368 (Rattus norvegicus), 607880 (Canis lupus familiaris), 614927 (Bos taurus), 708678 (Macaca mulatta) |
| Gene Symbols & Synonyms | IL27,Il27,p28,IL30,IL-27,IL27A,IL-27A,IL27p28,Il30,IL27-A,IL-27-A,IL-27p28,RGD1561420,IL-27alpha |
| Target Alternative Names | IL-27,IL-27 subunit alpha,IL-27-A,IL-27A,IL-27alpha,IL-27p28,IL27,IL27-A,IL27A,IL27p28,IL30,Il27,Il30,Interleukin-27 subunit alpha,Interleukin-30,RGD1561420,p28 |
| Uniprot Accession |
Q8K3I6,Q8NEV9
Additional SwissProt Accessions: Q8NEV9,Q8K3I6 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | |
| Disease | cancer |
| Disease from KEGG | Cytokine-cytokine receptor interaction, Th17 cell differentiation |
| Gene Ensembl | ENSECAG00000014957, ENSG00000197272, ENSMUSG00000044701, ENSCAFG00845002305, ENSBTAG00000018015, ENSMMUG00000045351 |
| Target Classification | Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


