Human CRH/CRF/CRH1 ORF/cDNA clone-Lentivirus plasmid (NM_000756)

Cat. No.: pGMLP002742
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CRH/CRF/CRH1 Lentiviral expression plasmid for CRH lentivirus packaging, CRH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CRH/CRF/CRH/CRF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $447.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002742
Gene Name CRH
Accession Number NM_000756
Gene ID 1392
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 591 bp
Gene Alias CRF,CRH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGCTGCCGCTGCTTGTGTCCGCGGGAGTCCTGCTGGTGGCTCTCCTGCCCTGCCCGCCATGCAGGGCGCTCCTGAGCCGCGGGCCGGTCCCGGGAGCTCGGCAGGCGCCGCAGCACCCTCAGCCCTTGGATTTCTTCCAGCCGCCGCCGCAGTCCGAGCAGCCCCAGCAGCCGCAGGCTCGGCCGGTCCTGCTCCGCATGGGAGAGGAGTACTTCCTCCGCCTGGGGAACCTCAACAAGAGCCCGGCCGCTCCCCTTTCGCCCGCCTCCTCGCTCCTCGCCGGAGGCAGCGGCAGCCGCCCTTCGCCGGAACAGGCGACCGCCAACTTTTTCCGCGTGTTGCTGCAGCAGCTGCTGCTGCCTCGGCGCTCGCTCGACAGCCCCGCGGCTCTCGCGGAGCGCGGCGCTAGGAATGCCCTCGGCGGCCACCAGGAGGCACCGGAGAGAGAAAGGCGGTCCGAGGAGCCTCCCATCTCCCTGGATCTCACCTTCCACCTCCTCCGGGAAGTCTTGGAAATGGCCAGGGCCGAGCAGTTAGCACAGCAAGCTCACAGCAACAGGAAACTCATGGAGATTATTGGGAAATAA
ORF Protein Sequence MRLPLLVSAGVLLVALLPCPPCRALLSRGPVPGARQAPQHPQPLDFFQPPPQSEQPQQPQARPVLLRMGEEYFLRLGNLNKSPAAPLSPASSLLAGGSGSRPSPEQATANFFRVLLQQLLLPRRSLDSPAALAERGARNALGGHQEAPERERRSEEPPISLDLTFHLLREVLEMARAEQLAQQAHSNRKLMEIIGK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T64137-Ab Anti-CRF/ CRH/ CRF1 functional antibody
    Target Antigen GM-Tg-g-T64137-Ag CRH protein
    ORF Viral Vector pGMLP002742 Human CRH Lentivirus plasmid
    ORF Viral Vector vGMLP002742 Human CRH Lentivirus particle


    Target information

    Target ID GM-T64137
    Target Name CRH/CRF
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1392
    Gene ID 100063840 (Equus caballus), 12918 (Mus musculus), 1392 (Homo sapiens), 280755 (Bos taurus)
    486977 (Canis lupus familiaris), 692345 (Felis catus), 702877 (Macaca mulatta), 81648 (Rattus norvegicus)
    Gene Symbols & Synonyms CRH,Crh,CRF,Gm1347,CRH1
    Target Alternative Names CRF,CRH,CRH1,Corticoliberin,Corticotropin-releasing factor (CRF),Corticotropin-releasing hormone,Crh,Gm1347
    Uniprot Accession P01143,P06850,P49926,Q8CIT0,Q95MI6
    Additional SwissProt Accessions: Q8CIT0,P06850,Q95MI6,P49926,P01143
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease
    Disease from KEGG cAMP signaling pathway, Neuroactive ligand-receptor interaction, Cushing syndrome
    Gene Ensembl ENSECAG00000047445, ENSMUSG00000049796, ENSG00000147571, ENSBTAG00000033128, ENSCAFG00845018776, ENSMMUG00000021587
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.