Human CCL22/A-152E5.1/ABCD-1 ORF/cDNA clone-Lentivirus plasmid (NM_002990)

Cat. No.: pGMLP002730
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL22/A-152E5.1/ABCD-1 Lentiviral expression plasmid for CCL22 lentivirus packaging, CCL22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CCL22/MDC/CCL22/A-152E5.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002730
Gene Name CCL22
Accession Number NM_002990
Gene ID 6367
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 282 bp
Gene Alias A-152E5.1,ABCD-1,DC/B-CK,MDC,SCYA22,STCP-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCGCCTACAGACTGCACTCCTGGTTGTCCTCGTCCTCCTTGCTGTGGCGCTTCAAGCAACTGAGGCAGGCCCCTACGGCGCCAACATGGAAGACAGCGTCTGCTGCCGTGATTACGTCCGTTACCGTCTGCCCCTGCGCGTGGTGAAACACTTCTACTGGACCTCAGACTCCTGCCCGAGGCCTGGCGTGGTGTTGCTAACCTTCAGGGATAAGGAGATCTGTGCCGATCCCAGAGTGCCCTGGGTGAAGATGATTCTCAATAAGCTGAGCCAATGA
ORF Protein Sequence MDRLQTALLVVLVLLAVALQATEAGPYGANMEDSVCCRDYVRYRLPLRVVKHFYWTSDSCPRPGVVLLTFRDKEICADPRVPWVKMILNKLSQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22117-Ab Anti-CCL22/ MDC/ A-152E5.1 functional antibody
    Target Antigen GM-Tg-g-T22117-Ag MDC/CCL22 protein
    Cytokine cks-Tg-g-GM-T22117 chemokine (C-C motif) ligand 22 (CCL22) protein & antibody
    ORF Viral Vector pGMLP002730 Human CCL22 Lentivirus plasmid
    ORF Viral Vector vGMLP002730 Human CCL22 Lentivirus particle


    Target information

    Target ID GM-T22117
    Target Name CCL22/MDC
    Gene Group Identifier
    （Target Gene ID in Homo species)         		6367
    Gene ID 100062332 (Equus caballus), 100428046 (Macaca mulatta), 100686212 (Canis lupus familiaris), 101091326 (Felis catus)
    117551 (Rattus norvegicus), 20299 (Mus musculus), 616996 (Bos taurus), 6367 (Homo sapiens)
    Gene Symbols & Synonyms CCL22,Ccl22,Mdc,Scya22,MDC,DCBCK,ABCD-1,SCYA22,STCP-1,DC/B-CK,A-152E5.1
    Target Alternative Names A-152E5.1,ABCD-1,C-C motif chemokine 22,CC chemokine STCP-1,CCL22,Ccl22,DC/B-CK,DCBCK,MDC,MDC(1-69),Macrophage-derived chemokine,Mdc,SCYA22,STCP-1,Scya22,Small-inducible cytokine A22,Stimulated T-cell chemotactic protein 1
    Uniprot Accession O00626,O88430
    Additional SwissProt Accessions: O88430,O00626
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer, Breast Cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway, C-type lectin receptor signaling pathway
    Gene Ensembl ENSECAG00000040031, ENSMMUG00000052508, ENSCAFG00845003433, ENSMUSG00000031779, ENSBTAG00000017718, ENSG00000102962
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.