Human APCS/HEL-S-92n/PTX2 ORF/cDNA clone-Lentivirus plasmid (NM_001639)

Cat. No.: pGMLP002714
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human APCS/HEL-S-92n/PTX2 Lentiviral expression plasmid for APCS lentivirus packaging, APCS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Serum amyloid P component/APCS/APCS/HEL-S-92n products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002714
Gene Name APCS
Accession Number NM_001639
Gene ID 325
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 672 bp
Gene Alias HEL-S-92n,PTX2,SAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACAAGCCGCTGCTTTGGATCTCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTTGGAGAGTATAGTCTATACATTGGAAGACACAAAGTTACATCCAAAGTTATCGAAAAGTTCCCGGCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATCAATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTTTGTAGAAGCTCAGCCCAAGATTGTCCTGGGGCAGGAACAGGATTCCTATGGGGGCAAGTTTGATAGGAGCCAGTCCTTTGTGGGAGAGATTGGGGATTTGTACATGTGGGACTCTGTGCTGCCCCCAGAAAATATCCTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAATATCCTGGACTGGCAGGCTCTGAACTATGAAATCAGAGGATATGTCATCATCAAACCCTTGGTGTGGGTCTGA
ORF Protein Sequence MNKPLLWISVLTSLLEAFAHTDLSGKVFVFPRESVTDHVNLITPLEKPLQNFTLCFRAYSDLSRAYSLFSYNTQGRDNELLVYKERVGEYSLYIGRHKVTSKVIEKFPAPVHICVSWESSSGIAEFWINGTPLVKKGLRQGYFVEAQPKIVLGQEQDSYGGKFDRSQSFVGEIGDLYMWDSVLPPENILSAYQGTPLPANILDWQALNYEIRGYVIIKPLVWV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-144 Pre-Made Dezamizumab biosimilar, Whole mAb, Anti-APCS Antibody: Anti-HEL-S-92n/PTX2/SAP therapeutic antibody
    Target Antibody GM-Tg-g-T37742-Ab Anti-SAMP/ APCS/ HEL-S-92n functional antibody
    Target Antigen GM-Tg-g-T37742-Ag APCS protein
    ORF Viral Vector pGMLP002714 Human APCS Lentivirus plasmid
    ORF Viral Vector vGMLP002714 Human APCS Lentivirus particle


    Target information

    Target ID GM-T37742
    Target Name Serum amyloid P component/APCS
    Gene Group Identifier
    （Target Gene ID in Homo species)         		325
    Gene ID 100053475 (Equus caballus), 101093332 (Felis catus), 20219 (Mus musculus), 29339 (Rattus norvegicus)
    325 (Homo sapiens), 514488 (Bos taurus), 719421 (Macaca mulatta)
    Gene Symbols & Synonyms APCS,Apcs,Sap,SAP,PTX2,HEL-S-92n
    Target Alternative Names 9.5S alpha-1-glycoprotein,APCS,Apcs,HEL-S-92n,PTX2,SAP,Sap,Serum amyloid P component,Serum amyloid P-component
    Uniprot Accession P02743,P12246,P23680,Q3T004
    Additional SwissProt Accessions: P12246,P23680,P02743,Q3T004
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease cancer, Ovary Cancer, Other diseases of intestines (K55-K64)
    Disease from KEGG
    Gene Ensembl ENSMUSG00000026542, ENSG00000132703, ENSBTAG00000019616, ENSMMUG00000006685
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.