Human CMPK1/CK/CMK ORF/cDNA clone-Lentivirus plasmid (NM_016308)

Cat. No.: pGMLP002463
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CMPK1/CK/CMK Lentiviral expression plasmid for CMPK1 lentivirus packaging, CMPK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CMPK1/UMP/CMPK1/CK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $471.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002463
Gene Name CMPK1
Accession Number NM_016308
Gene ID 51727
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 687 bp
Gene Alias CK,CMK,CMPK,UMK,UMP-CMPK,UMPK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGAGCCGCTGCCGCAGCGGGCTGCTCCACGTCCTGGGCCTTAGCTTCCTGCTGCAGACCCGCCGGCCGATTCTCCTCTGCTCTCCACGTCTCATGAAGCCGCTGGTCGTGTTCGTCCTCGGCGGCCCCGGCGCCGGCAAGGGGACCCAGTGCGCCCGCATCGTCGAGAAATATGGCTACACACACCTTTCTGCAGGAGAGCTGCTTCGTGATGAAAGGAAGAACCCAGATTCACAGTATGGTGAACTTATTGAAAAGTACATTAAAGAAGGAAAGATTGTACCAGTTGAGATAACCATCAGTTTATTAAAGAGGGAAATGGATCAGACAATGGCTGCCAATGCTCAGAAGAATAAATTCTTGATTGATGGGTTTCCAAGAAATCAAGACAACCTTCAAGGATGGAACAAGACCATGGATGGGAAGGCAGATGTATCTTTCGTTCTCTTTTTTGACTGTAATAATGAGATTTGTATTGAACGATGTCTTGAGAGGGGAAAGAGTAGTGGTAGGAGTGATGACAACAGAGAGAGCTTGGAAAAGAGAATTCAGACCTACCTTCAGTCAACAAAGCCAATTATTGACTTATATGAAGAAATGGGGAAAGTCAAGAAAATAGATGCTTCTAAATCTGTTGATGAAGTTTTTGATGAAGTTGTGCAGATTTTTGACAAGGAAGGCTAA
ORF Protein Sequence MLSRCRSGLLHVLGLSFLLQTRRPILLCSPRLMKPLVVFVLGGPGAGKGTQCARIVEKYGYTHLSAGELLRDERKNPDSQYGELIEKYIKEGKIVPVEITISLLKREMDQTMAANAQKNKFLIDGFPRNQDNLQGWNKTMDGKADVSFVLFFDCNNEICIERCLERGKSSGRSDDNRESLEKRIQTYLQSTKPIIDLYEEMGKVKKIDASKSVDEVFDEVVQIFDKEG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1554-Ab Anti-KCY/ CMPK1/ CK functional antibody
    Target Antigen GM-Tg-g-SE1554-Ag CMPK1 protein
    ORF Viral Vector pGMLP002463 Human CMPK1 Lentivirus plasmid
    ORF Viral Vector vGMLP002463 Human CMPK1 Lentivirus particle


    Target information

    Target ID GM-SE1554
    Target Name CMPK1/UMP
    Gene Group Identifier
    (Target Gene ID in Homo species)
    51727
    Gene ID 100063738 (Equus caballus), 105260825 (Felis catus), 298410 (Rattus norvegicus), 509965 (Bos taurus)
    51727 (Homo sapiens), 610291 (Canis lupus familiaris), 66588 (Mus musculus), 710196 (Macaca mulatta)
    Gene Symbols & Synonyms CMPK1,Cmpk1,CK,Cmpk,RGD1310116,CMPK,CMK,UMK,UMPK,UMP-CMPK,UMP-CMPk,0610011D08Rik
    Target Alternative Names 0610011D08Rik,CK,CMK,CMPK,CMPK1,Cmpk,Cmpk1,Deoxycytidylate kinase (CK,Nucleoside-diphosphate kinase,RGD1310116,UMK,UMP,UMP-CMP kinase,UMP-CMPK,UMP-CMPk,UMP/CMPK),UMPK,Uridine monophosphate/cytidine monophosphate kinase (UMP/CMP kinase,dCMP kinase)
    Uniprot Accession P30085,Q2KIW9,Q4KM73,Q9DBP5
    Additional SwissProt Accessions: Q4KM73,Q2KIW9,P30085,Q9DBP5
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG Metabolic pathways
    Gene Ensembl ENSECAG00000000428, ENSBTAG00000019956, ENSG00000162368, ENSCAFG00845016195, ENSMUSG00000028719, ENSMMUG00000017375
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.