Human GJB5/CX31.1 ORF/cDNA clone-Lentivirus plasmid (NM_005268)

Cat. No.: pGMLP002458
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GJB5/CX31.1 Lentiviral expression plasmid for GJB5 lentivirus packaging, GJB5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GJB5/Cx31.1/GJB5/CX31.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $505.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002458
Gene Name GJB5
Accession Number NM_005268
Gene ID 2709
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 822 bp
Gene Alias CX31.1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACTGGAGTATCTTTGAGGGACTCCTGAGTGGGGTCAACAAGTACTCCACAGCCTTTGGGCGCATCTGGCTGTCTCTGGTCTTCATCTTCCGCGTGCTGGTGTACCTGGTGACGGCCGAGCGTGTGTGGAGTGATGACCACAAGGACTTCGACTGCAATACTCGCCAGCCCGGCTGCTCCAACGTCTGCTTTGATGAGTTCTTCCCTGTGTCCCATGTGCGCCTCTGGGCCCTGCAGCTTATCCTGGTGACATGCCCCTCACTGCTCGTGGTCATGCACGTGGCCTACCGGGAGGTTCAGGAGAAGAGGCACCGAGAAGCCCATGGGGAGAACAGTGGGCGCCTCTACCTGAACCCCGGCAAGAAGCGGGGTGGGCTCTGGTGGACATATGTCTGCAGCCTAGTGTTCAAGGCGAGCGTGGACATCGCCTTTCTCTATGTGTTCCACTCATTCTACCCCAAATATATCCTCCCTCCTGTGGTCAAGTGCCACGCAGATCCATGTCCCAATATAGTGGACTGCTTCATCTCCAAGCCCTCAGAGAAGAACATTTTCACCCTCTTCATGGTGGCCACAGCTGCCATCTGCATCCTGCTCAACCTCGTGGAGCTCATCTACCTGGTGAGCAAGAGATGCCACGAGTGCCTGGCAGCAAGGAAAGCTCAAGCCATGTGCACAGGTCATCACCCCCACGGTACCACCTCTTCCTGCAAACAAGACGACCTCCTTTCGGGTGACCTCATCTTTCTGGGCTCAGACAGTCATCCTCCTCTCTTACCAGACCGCCCCCGAGACCATGTGAAGAAAACCATCTTGTGA
ORF Protein Sequence MNWSIFEGLLSGVNKYSTAFGRIWLSLVFIFRVLVYLVTAERVWSDDHKDFDCNTRQPGCSNVCFDEFFPVSHVRLWALQLILVTCPSLLVVMHVAYREVQEKRHREAHGENSGRLYLNPGKKRGGLWWTYVCSLVFKASVDIAFLYVFHSFYPKYILPPVVKCHADPCPNIVDCFISKPSEKNIFTLFMVATAAICILLNLVELIYLVSKRCHECLAARKAQAMCTGHHPHGTTSSCKQDDLLSGDLIFLGSDSHPPLLPDRPRDHVKKTIL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0172-Ab Anti-Cx31.1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0172-Ag Cx31.1/GJB5 protein
    ORF Viral Vector pGMLP002458 Human GJB5 Lentivirus plasmid
    ORF Viral Vector vGMLP002458 Human GJB5 Lentivirus particle


    Target information

    Target ID GM-IP0172
    Target Name GJB5/Cx31.1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2709
    Gene ID 100055619 (Equus caballus), 101083279 (Felis catus), 14622 (Mus musculus), 2709 (Homo sapiens)
    29586 (Rattus norvegicus), 482488 (Canis lupus familiaris), 524030 (Bos taurus), 711078 (Macaca mulatta)
    Gene Symbols & Synonyms GJB5,Gjb5,CXNA,Cxna,Gjb-5,Cx31.1,Cnx31.1,CX31.1
    Target Alternative Names CX31.1,CXNA,Cnx31.1,Connexin-31.1 (Cx31.1),Cx31.1,Cxna,GJB5,Gap junction beta-5 protein,Gjb-5,Gjb5
    Uniprot Accession O95377,P28232,Q02739
    Additional SwissProt Accessions: Q02739,O95377,P28232
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000050716, ENSMUSG00000042357, ENSG00000189280, ENSCAFG00845015493, ENSBTAG00000005717, ENSMMUG00000001859
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.