Human GSTA1/GST-epsilon/GST2 ORF/cDNA clone-Lentivirus plasmid (NM_145740)

Cat. No.: pGMLP002281
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GSTA1/GST-epsilon/GST2 Lentiviral expression plasmid for GSTA1 lentivirus packaging, GSTA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GSTA1/GST-epsilon products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $467.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002281
Gene Name GSTA1
Accession Number NM_145740
Gene ID 2938
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 669 bp
Gene Alias GST-epsilon,GST2,GSTA1-1,GTH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGAGAAGCCCAAGCTCCACTACTTCAATGCACGGGGCAGAATGGAGTCCACCCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAGCTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAAGACATAAAGGAGAGAGCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGTGGAACTTCTCTACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGGAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTTTAA
ORF Protein Sequence MAEKPKLHYFNARGRMESTRWLLAAAGVEFEEKFIKSAEDLDKLRNDGYLMFQQVPMVEIDGMKLVQTRAILNYIASKYNLYGKDIKERALIDMYIEGIADLGEMILLLPVCPPEEKDAKLALIKEKIKNRYFPAFEKVLKSHGQDYLVGNKLSRADIHLVELLYYVEELDSSLISSFPLLKALKTRISNLPTVKKFLQPGSPRKPPMDEKSLEEARKIFRF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T17221-Ab Anti-GSTA1 monoclonal antibody
    Target Antigen GM-Tg-g-T17221-Ag GSTA1 protein
    ORF Viral Vector pGMLP001199 Human GSTA1 Lentivirus plasmid
    ORF Viral Vector pGMLP002281 Human GSTA1 Lentivirus plasmid
    ORF Viral Vector vGMLP001199 Human GSTA1 Lentivirus particle
    ORF Viral Vector vGMLP002281 Human GSTA1 Lentivirus particle


    Target information

    Target ID GM-T17221
    Target Name GSTA1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2938
    Gene ID 2938 (Homo sapiens)
    Gene Symbols & Synonyms GSTA1,GST2,GTH1,GSTA1-1,GST-epsilon
    Target Alternative Names GSTA1,Glutathione S-transferase A1,13-hydroperoxyoctadecadienoate peroxidase, Androst-5-ene-3,17-dione isomerase, GST HA subunit 1, GST class-alpha member 1, GST-epsilon, GSTA1-1, GTH1,GST2,GTH1,GSTA1-1,GST-epsilon
    Uniprot Accession P08263
    Additional SwissProt Accessions: P08263
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer, Prostate Cancer
    Disease from KEGG Metabolic pathways, Pathways in cancer, Chemical carcinogenesis - DNA adducts, Chemical carcinogenesis - receptor activation, Hepatocellular carcinoma, Fluid shear stress and atherosclerosis, Drug metabolism - cytochrome P450
    Gene Ensembl ENSG00000243955
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.