Human RNASEH2A/AGS4/JUNB ORF/cDNA clone-Lentivirus plasmid (NM_006397)

Cat. No.: pGMLP002179
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RNASEH2A/AGS4/JUNB Lentiviral expression plasmid for RNASEH2A lentivirus packaging, RNASEH2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to RNASEH2A/AGS4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $525
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002179
Gene Name RNASEH2A
Accession Number NM_006397
Gene ID 10535
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 900 bp
Gene Alias AGS4,JUNB,RNASEHI,RNHIA,RNHL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCTCAGCGAGCTGGAGAGAGACAATACAGGCCGCTGTCGCCTGAGTTCGCCTGTGCCCGCGGTGTGCCGCAAGGAGCCTTGCGTCCTGGGCGTCGATGAGGCGGGCAGGGGCCCCGTGCTGGGCCCCATGGTCTACGCCATCTGTTATTGTCCCCTGCCTCGCCTGGCAGATCTGGAGGCGCTGAAAGTGGCAGACTCAAAGACCCTATTGGAGAGCGAGCGGGAAAGGCTGTTTGCGAAAATGGAGGACACGGACTTTGTCGGCTGGGCGCTGGATGTGCTGTCTCCAAACCTCATCTCTACCAGCATGCTTGGGCGGGTCAAATACAACCTGAACTCCCTGTCACATGATACAGCCACTGGGCTTATACAGTATGCATTGGACCAGGGCGTGAACGTCACCCAGGTATTCGTGGACACCGTAGGGATGCCAGAGACATACCAGGCGCGGCTGCAGCAAAGTTTTCCCGGGATTGAGGTGACGGTCAAGGCCAAAGCAGATGCCCTCTACCCGGTGGTTAGTGCTGCCAGCATCTGTGCCAAGGTGGCCCGGGACCAGGCCGTGAAGAAATGGCAGTTCGTGGAGAAACTGCAGGACTTGGATACTGATTATGGCTCAGGCTACCCCAATGATCCCAAGACAAAAGCGTGGTTGAAGGAGCACGTGGAGCCTGTGTTCGGCTTCCCCCAGTTTGTCCGGTTCAGCTGGCGCACGGCCCAGACCATCCTGGAGAAAGAGGCGGAAGATGTTATATGGGAGGACTCAGCATCCGAGAATCAGGAGGGACTCAGGAAGATCACATCCTACTTCCTCAATGAAGGGTCCCAAGCCCGTCCCCGTTCTTCCCACCGATATTTCCTGGAACGCGGCCTGGAGTCAGCAACCAGCCTCTAG
ORF Protein Sequence MDLSELERDNTGRCRLSSPVPAVCRKEPCVLGVDEAGRGPVLGPMVYAICYCPLPRLADLEALKVADSKTLLESERERLFAKMEDTDFVGWALDVLSPNLISTSMLGRVKYNLNSLSHDTATGLIQYALDQGVNVTQVFVDTVGMPETYQARLQQSFPGIEVTVKAKADALYPVVSAASICAKVARDQAVKKWQFVEKLQDLDTDYGSGYPNDPKTKAWLKEHVEPVFGFPQFVRFSWRTAQTILEKEAEDVIWEDSASENQEGLRKITSYFLNEGSQARPRSSHRYFLERGLESATSL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA020-Ab Anti-RNASEH2A monoclonal antibody
    Target Antigen GM-Tg-g-TA020-Ag RNASEH2A protein
    ORF Viral Vector pGMLP002179 Human RNASEH2A Lentivirus plasmid
    ORF Viral Vector vGMLP002179 Human RNASEH2A Lentivirus particle


    Target information

    Target ID GM-TA020
    Target Name RNASEH2A
    Gene Group Identifier
    （Target Gene ID in Homo species)         		10535
    Gene ID 100064237 (Equus caballus), 100856442 (Canis lupus familiaris), 101086121 (Felis catus), 10535 (Homo sapiens)
    364974 (Rattus norvegicus), 512830 (Bos taurus), 69724 (Mus musculus), 716701 (Macaca mulatta)
    Gene Symbols & Synonyms RNASEH2A,Rnaseh2a,AGS4,JUNB,RNHL,RNHIA,RNASEHI,2400006P09Rik
    Target Alternative Names RNASEH2A,Ribonuclease H2 subunit A,RNase H2 subunit A,Aicardi-Goutieres syndrome 4 protein (AGS4), RNase H(35), Ribonuclease HI large subunit (RNase HI large subunit), Ribonuclease HI subunit A,AGS4,JUNB,RNHL,RNHIA,RNASEHI
    Uniprot Accession O75792,Q2TBT5,Q5U209,Q9CWY8
    Additional SwissProt Accessions: O75792,Q5U209,Q2TBT5,Q9CWY8
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000007013, ENSCAFG00845015846, ENSG00000104889, ENSBTAG00000009661, ENSMUSG00000052926, ENSMMUG00000045010
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.