Human F3/CD142/TF ORF/cDNA clone-Lentivirus plasmid (NM_001993)

Cat. No.: pGMLP002095
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human F3/CD142/TF Lentiviral expression plasmid for F3 lentivirus packaging, F3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to F3/Tissue Factor/Coagulation Factor III/CD142/F3/CD142 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $522
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002095
Gene Name F3
Accession Number NM_001993
Gene ID 2152
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 888 bp
Gene Alias CD142,TF,TFA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGACCCCTGCCTGGCCCCGGGTCCCGCGCCCCGAGACCGCCGTCGCTCGGACGCTCCTGCTCGGCTGGGTCTTCGCCCAGGTGGCCGGCGCTTCAGGCACTACAAATACTGTGGCAGCATATAATTTAACTTGGAAATCAACTAATTTCAAGACAATTTTGGAGTGGGAACCCAAACCCGTCAATCAAGTCTACACTGTTCAAATAAGCACTAAGTCAGGAGATTGGAAAAGCAAATGCTTTTACACAACAGACACAGAGTGTGACCTCACCGACGAGATTGTGAAGGATGTGAAGCAGACGTACTTGGCACGGGTCTTCTCCTACCCGGCAGGGAATGTGGAGAGCACCGGTTCTGCTGGGGAGCCTCTGTATGAGAACTCCCCAGAGTTCACACCTTACCTGGAGACAAACCTCGGACAGCCAACAATTCAGAGTTTTGAACAGGTGGGAACAAAAGTGAATGTGACCGTAGAAGATGAACGGACTTTAGTCAGAAGGAACAACACTTTCCTAAGCCTCCGGGATGTTTTTGGCAAGGACTTAATTTATACACTTTATTATTGGAAATCTTCAAGTTCAGGAAAGAAAACAGCCAAAACAAACACTAATGAGTTTTTGATTGATGTGGATAAAGGAGAAAACTACTGTTTCAGTGTTCAAGCAGTGATTCCCTCCCGAACAGTTAACCGGAAGAGTACAGACAGCCCGGTAGAGTGTATGGGCCAGGAGAAAGGGGAATTCAGAGAAATATTCTACATCATTGGAGCTGTGGTATTTGTGGTCATCATCCTTGTCATCATCCTGGCTATATCTCTACACAAGTGTAGAAAGGCAGGAGTGGGGCAGAGCTGGAAGGAGAACTCCCCACTGAATGTTTCATAA
ORF Protein Sequence METPAWPRVPRPETAVARTLLLGWVFAQVAGASGTTNTVAAYNLTWKSTNFKTILEWEPKPVNQVYTVQISTKSGDWKSKCFYTTDTECDLTDEIVKDVKQTYLARVFSYPAGNVESTGSAGEPLYENSPEFTPYLETNLGQPTIQSFEQVGTKVNVTVEDERTLVRRNNTFLSLRDVFGKDLIYTLYYWKSSSSGKKTAKTNTNEFLIDVDKGENYCFSVQAVIPSRTVNRKSTDSPVECMGQEKGEFREIFYIIGAVVFVVIILVIILAISLHKCRKAGVGQSWKENSPLNVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-582 Pre-Made Tisotumab biosimilar, Whole mAb, Anti-F3 Antibody: Anti-CD142/TF/TFA therapeutic antibody
    Biosimilar GMP-Bios-INN-1024 Pre-Made Tisotumab Vedotin Biosimilar, Whole Mab Adc, Anti-F3 Antibody: Anti-CD142/TF/TFA therapeutic antibody Drug Conjugate
    Target Antibody GM-Tg-g-T72702-Ab Anti-TF/ F3/ CD142 monoclonal antibody
    Target Antigen GM-Tg-g-T72702-Ag F3 VLP (virus-like particle)
    ORF Viral Vector pGMLP002095 Human F3 Lentivirus plasmid
    ORF Viral Vector vGMLP002095 Human F3 Lentivirus particle


    Target information

    Target ID GM-T72702
    Target Name F3/Tissue Factor/Coagulation Factor III/CD142
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2152
    Gene ID 100058506 (Equus caballus), 101082330 (Felis catus), 14066 (Mus musculus), 2152 (Homo sapiens)
    25584 (Rattus norvegicus), 280686 (Bos taurus), 490153 (Canis lupus familiaris), 714456 (Macaca mulatta)
    Gene Symbols & Synonyms F3,TF,Cf3,Cf-3,CD142,TFA
    Target Alternative Names CD142,Cf-3,Cf3,Coagulation Factor III,Coagulation factor III,F3,TF,TFA,Thromboplastin,Tissue Factor,Tissue factor
    Uniprot Accession P13726,P20352,P30931,P42533
    Additional SwissProt Accessions: P20352,P13726,P42533,P30931
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease
    Disease from KEGG Complement and coagulation cascades, AGE-RAGE signaling pathway in diabetic complications
    Gene Ensembl ENSMUSG00000028128, ENSG00000117525, ENSBTAG00000007101, ENSCAFG00845014757, ENSMMUG00000056548
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.