Human CD1D/CD1A/R3 ORF/cDNA clone-Lentivirus plasmid (NM_001766)

Cat. No.: pGMLP002053
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD1D/CD1A/R3 Lentiviral expression plasmid for CD1D lentivirus packaging, CD1D lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD1d/CD1D/CD1D/CD1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $582.24
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002053
Gene Name CD1D
Accession Number NM_001766
Gene ID 912
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1008 bp
Gene Alias CD1A,R3,R3G1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGTGCCTGCTGTTTCTGCTGCTCTGGGCGCTCCTCCAGGCTTGGGGAAGCGCTGAAGTCCCGCAAAGGCTTTTCCCCCTCCGCTGCCTCCAGATCTCGTCCTTCGCCAATAGCAGCTGGACGCGCACCGACGGCTTGGCGTGGCTGGGGGAGCTGCAGACGCACAGCTGGAGCAACGACTCGGACACCGTCCGCTCTCTGAAGCCTTGGTCCCAGGGCACGTTCAGCGACCAGCAGTGGGAGACGCTGCAGCATATATTTCGGGTTTATCGAAGCAGCTTCACCAGGGACGTGAAGGAATTCGCCAAAATGCTACGCTTATCCTATCCCTTGGAGCTCCAGGTGTCCGCTGGCTGTGAGGTGCACCCTGGGAACGCCTCAAATAACTTCTTCCATGTAGCATTTCAAGGAAAAGATATCCTGAGTTTCCAAGGAACTTCTTGGGAGCCAACCCAAGAGGCCCCACTTTGGGTAAACTTGGCCATTCAAGTGCTCAACCAGGACAAGTGGACGAGGGAAACAGTGCAGTGGCTCCTTAATGGCACCTGCCCCCAATTTGTCAGTGGCCTCCTTGAGTCAGGGAAGTCGGAACTGAAGAAGCAAGTGAAGCCCAAGGCCTGGCTGTCCCGTGGCCCCAGTCCTGGCCCTGGCCGTCTGCTGCTGGTGTGCCATGTCTCAGGATTCTACCCAAAGCCTGTATGGGTGAAGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCCAGGGGACATCCTGCCCAATGCTGACGAGACATGGTATCTCCGAGCAACCCTGGATGTGGTGGCTGGGGAGGCAGCTGGCCTGTCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGGTGGGAGCTACACCTCCATGGGCTTGATTGCCTTGGCAGTCCTGGCGTGCTTGCTGTTCCTCCTCATTGTGGGCTTTACCTCCCGGTTTAAGAGGCAAACTTCCTATCAGGGCGTCCTGTGA
ORF Protein Sequence MGCLLFLLLWALLQAWGSAEVPQRLFPLRCLQISSFANSSWTRTDGLAWLGELQTHSWSNDSDTVRSLKPWSQGTFSDQQWETLQHIFRVYRSSFTRDVKEFAKMLRLSYPLELQVSAGCEVHPGNASNNFFHVAFQGKDILSFQGTSWEPTQEAPLWVNLAIQVLNQDKWTRETVQWLLNGTCPQFVSGLLESGKSELKKQVKPKAWLSRGPSPGPGRLLLVCHVSGFYPKPVWVKWMRGEQEQQGTQPGDILPNADETWYLRATLDVVAGEAAGLSCRVKHSSLEGQDIVLYWGGSYTSMGLIALAVLACLLFLLIVGFTSRFKRQTSYQGVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0200-Ab Anti-CD1D/ CD1A/ R3 monoclonal antibody
    Target Antigen GM-Tg-g-MP0200-Ag CD1D VLP (virus-like particle)
    ORF Viral Vector pGMLP002053 Human CD1D Lentivirus plasmid
    ORF Viral Vector vGMLP002053 Human CD1D Lentivirus particle


    Target information

    Target ID GM-MP0200
    Target Name CD1d/CD1D
    Gene Group Identifier
    (Target Gene ID in Homo species)
    912
    Gene ID 101100784 (Felis catus), 12479 (Mus musculus), 613268 (Macaca mulatta), 912 (Homo sapiens)
    Gene Symbols & Synonyms CD1D,Cd1d1,Cd1a,Cd1d,CD1.1,Ly-38,R3,CD1A,R3G1
    Target Alternative Names Antigen-presenting glycoprotein CD1d,CD1.1,CD1A,CD1D,CD1d,Cd1a,Cd1d,Cd1d1,Ly-38,R3,R3G1
    Uniprot Accession P11609,P15813
    Additional SwissProt Accessions: P11609,P15813
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease cancer
    Disease from KEGG Tight junction, Hematopoietic cell lineage, Amoebiasis
    Gene Ensembl ENSMUSG00000028076, ENSMMUG00000020156, ENSG00000158473
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.