Human ASGR1/ASGPR/ASGPR1 ORF/cDNA clone-Lentivirus plasmid (NM_001671)

Cat. No.: pGMLP002034
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ASGR1/ASGPR/ASGPR1 Lentiviral expression plasmid for ASGR1 lentivirus packaging, ASGR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ASGR1/ASGPR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $519
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002034
Gene Name ASGR1
Accession Number NM_001671
Gene ID 432
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 876 bp
Gene Alias ASGPR,ASGPR1,CLEC4H1,HL-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCAAGGAGTATCAAGACCTTCAGCATCTGGACAATGAGGAGAGTGACCACCATCAGCTCAGAAAAGGGCCACCTCCTCCCCAGCCCCTCCTGCAGCGTCTCTGCTCCGGACCTCGCCTCCTCCTGCTCTCCCTGGGCCTCAGCCTCCTGCTGCTTGTGGTTGTCTGTGTGATCGGATCCCAAAACTCCCAGCTGCAGGAGGAGCTGCGGGGCCTGAGAGAGACGTTCAGCAACTTCACAGCGAGCACGGAGGCCCAGGTCAAGGGCTTGAGCACCCAGGGAGGCAATGTGGGAAGAAAGATGAAGTCGCTAGAGTCCCAGCTGGAGAAACAGCAGAAGGACCTGAGTGAAGATCACTCCAGCCTGCTGCTCCACGTGAAGCAGTTCGTGTCTGACCTGCGGAGCCTGAGCTGTCAGATGGCGGCGCTCCAGGGCAATGGCTCAGAAAGGACCTGCTGCCCGGTCAACTGGGTGGAGCACGAGCGCAGCTGCTACTGGTTCTCTCGCTCCGGGAAGGCCTGGGCTGACGCCGACAACTACTGCCGGCTGGAGGACGCGCACCTGGTGGTGGTCACGTCCTGGGAGGAGCAGAAATTTGTCCAGCACCACATAGGCCCTGTGAACACCTGGATGGGCCTCCACGACCAAAACGGGCCCTGGAAGTGGGTGGACGGGACGGACTACGAGACGGGCTTCAAGAACTGGAGGCCGGAGCAGCCGGACGACTGGTACGGCCACGGGCTCGGAGGAGGCGAGGACTGTGCCCACTTCACCGACGACGGCCGCTGGAACGACGACGTCTGCCAGAGGCCCTACCGCTGGGTCTGCGAGACAGAGCTGGACAAGGCCAGCCAGGAGCCACCTCTCCTTTAA
ORF Protein Sequence MTKEYQDLQHLDNEESDHHQLRKGPPPPQPLLQRLCSGPRLLLLSLGLSLLLLVVVCVIGSQNSQLQEELRGLRETFSNFTASTEAQVKGLSTQGGNVGRKMKSLESQLEKQQKDLSEDHSSLLLHVKQFVSDLRSLSCQMAALQGNGSERTCCPVNWVEHERSCYWFSRSGKAWADADNYCRLEDAHLVVVTSWEEQKFVQHHIGPVNTWMGLHDQNGPWKWVDGTDYETGFKNWRPEQPDDWYGHGLGGGEDCAHFTDDGRWNDDVCQRPYRWVCETELDKASQEPPLL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32780-Ab Anti-ASGR1/ ASGPR/ ASGPR1 monoclonal antibody
    Target Antigen GM-Tg-g-T32780-Ag ASGR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002034 Human ASGR1 Lentivirus plasmid
    ORF Viral Vector pGMLV002104 Human ASGR1 Lentivirus plasmid
    ORF Viral Vector vGMLP002034 Human ASGR1 Lentivirus particle
    ORF Viral Vector vGMLV002104 Human ASGR1 Lentivirus particle


    Target information

    Target ID GM-T32780
    Target Name ASGR1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    432
    Gene ID 432 (Homo sapiens), 721786 (Macaca mulatta)
    Gene Symbols & Synonyms ASGR1,HL-1,ASGPR,ASGPR1,CLEC4H1
    Target Alternative Names ASGP-R 1,ASGPR,ASGPR 1,ASGPR1,ASGR1,Asialoglycoprotein receptor 1,C-type lectin domain family 4 member H1,CLEC4H1,HL-1,Hepatic lectin H1 (HL-1)
    Uniprot Accession P07306
    Additional SwissProt Accessions: P07306
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Thyroid hormone synthesis
    Gene Ensembl ENSG00000141505, ENSMMUG00000003247
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.