Human WNT3A ORF/cDNA clone-Lentivirus plasmid (NM_033131.3)
Cat. No.: pGMLP002017
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human WNT3A/ Lentiviral expression plasmid for WNT3A lentivirus packaging, WNT3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
WNT3A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP002017 |
| Gene Name | WNT3A |
| Accession Number | NM_033131.3 |
| Gene ID | 89780 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1059 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCCCACTCGGATACTTCTTACTCCTCTGCAGCCTGAAGCAGGCTCTGGGCAGCTACCCGATCTGGTGGTCGCTGGCTGTTGGGCCACAGTATTCCTCCCTGGGCTCGCAGCCCATCCTGTGTGCCAGCATCCCGGGCCTGGTCCCCAAGCAGCTCCGCTTCTGCAGGAACTACGTGGAGATCATGCCCAGCGTGGCCGAGGGCATCAAGATTGGCATCCAGGAGTGCCAGCACCAGTTCCGCGGCCGCCGGTGGAACTGCACCACCGTCCACGACAGCCTGGCCATCTTCGGGCCCGTGCTGGACAAAGCTACCAGGGAGTCGGCCTTTGTCCACGCCATTGCCTCAGCCGGTGTGGCCTTTGCAGTGACACGCTCATGTGCAGAAGGCACGGCCGCCATCTGTGGCTGCAGCAGCCGCCACCAGGGCTCACCAGGCAAGGGCTGGAAGTGGGGTGGCTGTAGCGAGGACATCGAGTTTGGTGGGATGGTGTCTCGGGAGTTCGCCGACGCCCGGGAGAACCGGCCAGATGCCCGCTCAGCCATGAACCGCCACAACAACGAGGCTGGGCGCCAGGCCATCGCCAGCCACATGCACCTCAAGTGCAAGTGCCACGGGCTGTCGGGCAGCTGCGAGGTGAAGACATGCTGGTGGTCGCAACCCGACTTCCGCGCCATCGGTGACTTCCTCAAGGACAAGTACGACAGCGCCTCGGAGATGGTGGTGGAGAAGCACCGGGAGTCCCGCGGCTGGGTGGAGACCCTGCGGCCGCGCTACACCTACTTCAAGGTGCCCACGGAGCGCGACCTGGTCTACTACGAGGCCTCGCCCAACTTCTGCGAGCCCAACCCTGAGACGGGCTCCTTCGGCACGCGCGACCGCACCTGCAACGTCAGCTCGCACGGCATCGACGGCTGCGACCTGCTGTGCTGCGGCCGCGGCCACAACGCGCGAGCGGAGCGGCGCCGGGAGAAGTGCCGCTGCGTGTTCCACTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACGCGCGTCTACGACGTGCACACCTGCAAGTAG |
| ORF Protein Sequence | MAPLGYFLLLCSLKQALGSYPIWWSLAVGPQYSSLGSQPILCASIPGLVPKQLRFCRNYVEIMPSVAEGIKIGIQECQHQFRGRRWNCTTVHDSLAIFGPVLDKATRESAFVHAIASAGVAFAVTRSCAEGTAAICGCSSRHQGSPGKGWKWGGCSEDIEFGGMVSREFADARENRPDARSAMNRHNNEAGRQAIASHMHLKCKCHGLSGSCEVKTCWWSQPDFRAIGDFLKDKYDSASEMVVEKHRESRGWVETLRPRYTYFKVPTERDLVYYEASPNFCEPNPETGSFGTRDRTCNVSSHGIDGCDLLCCGRGHNARAERRREKCRCVFHWCCYVSCQECTRVYDVHTCK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP2573-Ab | Anti-WNT3A monoclonal antibody |
| Target Antigen | GM-Tg-g-MP2573-Ag | WNT3A VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-MP2573 | wingless-type MMTV integration site family, member 3A (WNT3A) protein & antibody |
| ORF Viral Vector | pGMLP002017 | Human WNT3A Lentivirus plasmid |
| ORF Viral Vector | pGMLP005569 | Human WNT3A Lentivirus plasmid |
| ORF Viral Vector | vGMLP002017 | Human WNT3A Lentivirus particle |
| ORF Viral Vector | vGMLP005569 | Human WNT3A Lentivirus particle |
Target information
| Target ID | GM-MP2573 |
| Target Name | WNT3A |
|
Gene Group Identifier (Target Gene ID in Homo species) |
89780 |
| Gene ID |
100061145 (Equus caballus), 101080607 (Felis catus), 22416 (Mus musculus), 303181 (Rattus norvegicus) 482208 (Canis lupus familiaris), 522467 (Bos taurus), 696200 (Macaca mulatta), 89780 (Homo sapiens) |
| Gene Symbols & Synonyms | WNT3A,Wnt3a,vt,Wnt-3a |
| Target Alternative Names | Protein Wnt-3a,WNT3A,Wnt-3a,Wnt3a,vt |
| Uniprot Accession |
P27467,P56704
Additional SwissProt Accessions: P27467,P56704 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Cytokine Target |
| Disease | cancer |
| Disease from KEGG | Wnt signaling pathway, Hippo signaling pathway, Signaling pathways regulating pluripotency of stem cells, Melanogenesis, Cushing syndrome, Alzheimer disease, Human papillomavirus infection, Pathways in cancer, Proteoglycans in cancer, Basal cell carcinoma, Breast cancer, Hepatocellular carcinoma, Gastric cancer |
| Gene Ensembl | ENSMUSG00000009900, ENSCAFG00845007960, ENSBTAG00000039397, ENSMMUG00000050712, ENSG00000154342 |
| Target Classification | Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


