Human KLF9/BTEB/BTEB1 ORF/cDNA clone-Lentivirus plasmid (NM_001206.2)
Cat. No.: pGMLP001959
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human KLF9/BTEB/BTEB1 Lentiviral expression plasmid for KLF9 lentivirus packaging, KLF9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
KLF9/BTEB products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001959 |
Gene Name | KLF9 |
Accession Number | NM_001206.2 |
Gene ID | 687 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 735 bp |
Gene Alias | BTEB,BTEB1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCCGCGGCCGCCTACATGGACTTCGTGGCTGCCCAGTGTCTGGTTTCCATTTCGAACCGCGCTGCGGTGCCGGAGCATGGGGTCGCTCCGGACGCCGAGCGGCTGCGACTACCTGAGCGCGAGGTGACCAAGGAGCACGGTGACCCGGGGGACACCTGGAAGGATTACTGCACACTGGTCACCATCGCCAAGAGCTTGTTGGACCTGAACAAGTACCGACCCATCCAGACCCCCTCCGTGTGCAGCGACAGTCTGGAAAGTCCAGATGAGGATATGGGATCCGACAGCGACGTGACCACCGAATCTGGGTCGAGTCCTTCCCACAGCCCGGAGGAGAGACAGGATCCTGGCAGCGCGCCCAGCCCGCTCTCCCTCCTCCATCCTGGAGTGGCTGCGAAGGGGAAACACGCCTCCGAAAAGAGGCACAAGTGCCCCTACAGTGGCTGTGGGAAAGTCTATGGAAAATCCTCCCATCTCAAAGCCCATTACAGAGTGCATACAGGTGAACGGCCCTTTCCCTGCACGTGGCCAGACTGCCTTAAAAAGTTCTCCCGCTCAGACGAGCTGACCCGCCACTACCGGACCCACACTGGGGAAAAGCAGTTCCGCTGTCCGCTGTGTGAGAAGCGCTTCATGAGGAGTGACCACCTCACAAAGCACGCCCGGCGGCACACCGAGTTCCACCCCAGCATGATCAAGCGATCGAAAAAGGCGCTGGCCAACGCTTTGTGA |
ORF Protein Sequence | MSAAAYMDFVAAQCLVSISNRAAVPEHGVAPDAERLRLPEREVTKEHGDPGDTWKDYCTLVTIAKSLLDLNKYRPIQTPSVCSDSLESPDEDMGSDSDVTTESGSSPSHSPEERQDPGSAPSPLSLLHPGVAAKGKHASEKRHKCPYSGCGKVYGKSSHLKAHYRVHTGERPFPCTWPDCLKKFSRSDELTRHYRTHTGEKQFRCPLCEKRFMRSDHLTKHARRHTEFHPSMIKRSKKALANAL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2176-Ab | Anti-KLF9/ BTEB/ BTEB1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2176-Ag | KLF9 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001959 | Human KLF9 Lentivirus plasmid |
ORF Viral Vector | vGMLP001959 | Human KLF9 Lentivirus particle |
Target information
Target ID | GM-MP2176 |
Target Name | KLF9 |
Gene Group Identifier (Target Gene ID in Homo species) |
687 |
Gene ID |
100050300 (Equus caballus), 101090808 (Felis catus), 117560 (Rattus norvegicus), 16601 (Mus musculus) 484172 (Canis lupus familiaris), 539139 (Bos taurus), 687 (Homo sapiens), 700585 (Macaca mulatta) |
Gene Symbols & Synonyms | KLF9,Klf9,Bteb,Bteb1,BTEB-1,Gm9971,2310051E17Rik,BTEB,BTEB1 |
Target Alternative Names | KLF9,Krueppel-like factor 9,Basic transcription element-binding protein 1 (BTE-binding protein 1), GC-box-binding protein 1, Transcription factor BTEB1,BTEB,BTEB1 |
Uniprot Accession |
O35739,Q01713,Q13886
Additional SwissProt Accessions: Q01713,O35739,Q13886 |
Uniprot Entry Name | |
Protein Sub-location | Transmembrane Protein |
Category | |
Disease | |
Disease from KEGG | |
Gene Ensembl | ENSECAG00000024925, ENSMUSG00000033863, ENSCAFG00845000628, ENSBTAG00000016229, ENSG00000119138, ENSMMUG00000063718 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.