Human F7/SPCA ORF/cDNA clone-Lentivirus plasmid (NM_019616.3)

Cat. No.: pGMLP001936
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human F7/SPCA Lentiviral expression plasmid for F7 lentivirus packaging, F7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to F7/SPCA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $673.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001936
Gene Name F7
Accession Number NM_019616.3
Gene ID 2155
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1335 bp
Gene Alias SPCA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTCTCCCAGGCCCTCAGGCTCCTCTGCCTTCTGCTTGGGCTTCAGGGCTGCCTGGCTGCAGTCTTCGTAACCCAGGAGGAAGCCCACGGCGTCCTGCACCGGCGCCGGCGCGCCAACGCGTTCCTGGAGGAGCTGCGGCCGGGCTCCCTGGAGAGGGAGTGCAAGGAGGAGCAGTGCTCCTTCGAGGAGGCCCGGGAGATCTTCAAGGACGCGGAGAGGACGAAGCTGTTCTGGATTTCTTACAGTGATGGGGACCAGTGTGCCTCAAGTCCATGCCAGAATGGGGGCTCCTGCAAGGACCAGCTCCAGTCCTATATCTGCTTCTGCCTCCCTGCCTTCGAGGGCCGGAACTGTGAGACGCACAAGGATGACCAGCTGATCTGTGTGAACGAGAACGGCGGCTGTGAGCAGTACTGCAGTGACCACACGGGCACCAAGCGCTCCTGTCGGTGCCACGAGGGGTACTCTCTGCTGGCAGACGGGGTGTCCTGCACACCCACAGTTGAATATCCATGTGGAAAAATACCTATTCTAGAAAAAAGAAATGCCAGCAAACCCCAAGGCCGAATTGTGGGGGGCAAGGTGTGCCCCAAAGGGGAGTGTCCATGGCAGGTCCTGTTGTTGGTGAATGGAGCTCAGTTGTGTGGGGGGACCCTGATCAACACCATCTGGGTGGTCTCCGCGGCCCACTGTTTCGACAAAATCAAGAACTGGAGGAACCTGATCGCGGTGCTGGGCGAGCACGACCTCAGCGAGCACGACGGGGATGAGCAGAGCCGGCGGGTGGCGCAGGTCATCATCCCCAGCACGTACGTCCCGGGCACCACCAACCACGACATCGCGCTGCTCCGCCTGCACCAGCCCGTGGTCCTCACTGACCATGTGGTGCCCCTCTGCCTGCCCGAACGGACGTTCTCTGAGAGGACGCTGGCCTTCGTGCGCTTCTCATTGGTCAGCGGCTGGGGCCAGCTGCTGGACCGTGGCGCCACGGCCCTGGAGCTCATGGTCCTCAACGTGCCCCGGCTGATGACCCAGGACTGCCTGCAGCAGTCACGGAAGGTGGGAGACTCCCCAAATATCACGGAGTACATGTTCTGTGCCGGCTACTCGGATGGCAGCAAGGACTCCTGCAAGGGGGACAGTGGAGGCCCACATGCCACCCACTACCGGGGCACGTGGTACCTGACGGGCATCGTCAGCTGGGGCCAGGGCTGCGCAACCGTGGGCCACTTTGGGGTGTACACCAGGGTCTCCCAGTACATCGAGTGGCTGCAAAAGCTCATGCGCTCAGAGCCACGCCCAGGAGTCCTCCTGCGAGCCCCATTTCCCTAG
ORF Protein Sequence MVSQALRLLCLLLGLQGCLAAVFVTQEEAHGVLHRRRRANAFLEELRPGSLERECKEEQCSFEEAREIFKDAERTKLFWISYSDGDQCASSPCQNGGSCKDQLQSYICFCLPAFEGRNCETHKDDQLICVNENGGCEQYCSDHTGTKRSCRCHEGYSLLADGVSCTPTVEYPCGKIPILEKRNASKPQGRIVGGKVCPKGECPWQVLLLVNGAQLCGGTLINTIWVVSAAHCFDKIKNWRNLIAVLGEHDLSEHDGDEQSRRVAQVIIPSTYVPGTTNHDIALLRLHQPVVLTDHVVPLCLPERTFSERTLAFVRFSLVSGWGQLLDRGATALELMVLNVPRLMTQDCLQQSRKVGDSPNITEYMFCAGYSDGSKDSCKGDSGGPHATHYRGTWYLTGIVSWGQGCATVGHFGVYTRVSQYIEWLQKLMRSEPRPGVLLRAPFP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-842 Pre-Made Eptacog Alfa (Actived Biosimilar, Recombinant Protein targeting F7: Recombinant therapeutic protein targeting SPCA
    Biosimilar GMP-Bios-INN-941 Pre-Made Oreptacog Alfa Biosimilar, Recombinant Protein targeting F7: Recombinant therapeutic protein targeting SPCA
    Target Antibody GM-Tg-g-T43332-Ab Anti-FA7/ F7/ SPCA monoclonal antibody
    Target Antigen GM-Tg-g-T43332-Ag F7 VLP (virus-like particle)
    ORF Viral Vector pGMLP001936 Human F7 Lentivirus plasmid
    ORF Viral Vector vGMLP001936 Human F7 Lentivirus particle


    Target information

    Target ID GM-T43332
    Target Name F7
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2155
    Gene ID 100067072 (Equus caballus), 101090581 (Felis catus), 14068 (Mus musculus), 2155 (Homo sapiens)
    260320 (Rattus norvegicus), 607661 (Canis lupus familiaris), 617960 (Bos taurus), 721933 (Macaca mulatta)
    Gene Symbols & Synonyms F7,Cf7,FVII,SPCA
    Target Alternative Names Cf7,Coagulation factor VII,F7,FVII,Proconvertin,SPCA,Serum prothrombin conversion accelerator (SPCA)
    Uniprot Accession P08709,P22457,P70375,Q8K3U6
    Additional SwissProt Accessions: P70375,P08709,Q8K3U6,P22457
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease
    Disease from KEGG Complement and coagulation cascades
    Gene Ensembl ENSECAG00000004998, ENSMUSG00000031443, ENSG00000057593, ENSCAFG00845024066, ENSBTAG00000007411, ENSMMUG00000001036
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.