Human SIRT2/SIR2/SIR2L ORF/cDNA clone-Lentivirus plasmid (NM_012237)

Cat. No.: pGMLP001425
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SIRT2/SIR2/SIR2L Lentiviral expression plasmid for SIRT2 lentivirus packaging, SIRT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SIRT2/SIR2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $627.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001425
Gene Name SIRT2
Accession Number NM_012237
Gene ID 22933
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1170 bp
Gene Alias SIR2,SIR2L,SIR2L2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGAGCCAGACCCCTCTCACCCTCTGGAGACCCAGGCAGGGAAGGTGCAGGAGGCTCAGGACTCAGATTCAGACTCTGAGGGAGGAGCCGCTGGTGGAGAAGCAGACATGGACTTCCTGCGGAACTTATTCTCCCAGACGCTCAGCCTGGGCAGCCAGAAGGAGCGTCTGCTGGACGAGCTGACCTTGGAAGGGGTGGCCCGGTACATGCAGAGCGAACGCTGTCGCAGAGTCATCTGTTTGGTGGGAGCTGGAATCTCCACATCCGCAGGCATCCCCGACTTTCGCTCTCCATCCACCGGCCTCTATGACAACCTAGAGAAGTACCATCTTCCCTACCCAGAGGCCATCTTTGAGATCAGCTATTTCAAGAAACATCCGGAACCCTTCTTCGCCCTCGCCAAGGAACTCTATCCTGGGCAGTTCAAGCCAACCATCTGTCACTACTTCATGCGCCTGCTGAAGGACAAGGGGCTACTCCTGCGCTGCTACACGCAGAACATAGATACCCTGGAGCGAATAGCCGGGCTGGAACAGGAGGACTTGGTGGAGGCGCACGGCACCTTCTACACATCACACTGCGTCAGCGCCAGCTGCCGGCACGAATACCCGCTAAGCTGGATGAAAGAGAAGATCTTCTCTGAGGTGACGCCCAAGTGTGAAGACTGTCAGAGCCTGGTGAAGCCTGATATCGTCTTTTTTGGTGAGAGCCTCCCAGCGCGTTTCTTCTCCTGTATGCAGTCAGACTTCCTGAAGGTGGACCTCCTCCTGGTCATGGGTACCTCCTTGCAGGTGCAGCCCTTTGCCTCCCTCATCAGCAAGGCACCCCTCTCCACCCCTCGCCTGCTCATCAACAAGGAGAAAGCTGGCCAGTCGGACCCTTTCCTGGGGATGATTATGGGCCTCGGAGGAGGCATGGACTTTGACTCCAAGAAGGCCTACAGGGACGTGGCCTGGCTGGGTGAATGCGACCAGGGCTGCCTGGCCCTTGCTGAGCTCCTTGGATGGAAGAAGGAGCTGGAGGACCTTGTCCGGAGGGAGCACGCCAGCATAGATGCCCAGTCGGGGGCGGGGGTCCCCAACCCCAGCACTTCAGCTTCCCCCAAGAAGTCCCCGCCACCTGCCAAGGACGAGGCCAGGACAACAGAGAGGGAGAAACCCCAGTGA
ORF Protein Sequence MAEPDPSHPLETQAGKVQEAQDSDSDSEGGAAGGEADMDFLRNLFSQTLSLGSQKERLLDELTLEGVARYMQSERCRRVICLVGAGISTSAGIPDFRSPSTGLYDNLEKYHLPYPEAIFEISYFKKHPEPFFALAKELYPGQFKPTICHYFMRLLKDKGLLLRCYTQNIDTLERIAGLEQEDLVEAHGTFYTSHCVSASCRHEYPLSWMKEKIFSEVTPKCEDCQSLVKPDIVFFGESLPARFFSCMQSDFLKVDLLLVMGTSLQVQPFASLISKAPLSTPRLLINKEKAGQSDPFLGMIMGLGGGMDFDSKKAYRDVAWLGECDQGCLALAELLGWKKELEDLVRREHASIDAQSGAGVPNPSTSASPKKSPPPAKDEARTTEREKPQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T83904-Ab Anti-SIRT2 monoclonal antibody
    Target Antigen GM-Tg-g-T83904-Ag SIRT2 protein
    ORF Viral Vector pGMLP001425 Human SIRT2 Lentivirus plasmid
    ORF Viral Vector pGMPC000307 Human SIRT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000562 Human SIRT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001357 Human SIRT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001425 Human SIRT2 Lentivirus particle


    Target information

    Target ID GM-T83904
    Target Name SIRT2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    22933
    Gene ID 100146611 (Equus caballus), 100425019 (Macaca mulatta), 101099513 (Felis catus), 22933 (Homo sapiens)
    361532 (Rattus norvegicus), 504463 (Bos taurus), 612558 (Canis lupus familiaris), 64383 (Mus musculus)
    Gene Symbols & Synonyms SIRT2,Sirt2,SIR2,SIR2L,SIR2L2,Sir2l,5730427M03Rik
    Target Alternative Names 5730427M03Rik,NAD-dependent protein deacetylase sirtuin-2,NAD-dependent protein defatty-acylase sirtuin-2,Regulatory protein SIR2 homolog 2,SIR2,SIR2-like protein 2,SIR2L,SIR2L2,SIRT2,Sir2l,Sirt2
    Uniprot Accession Q5RJQ4,Q8IXJ6,Q8VDQ8
    Additional SwissProt Accessions: Q8IXJ6,Q5RJQ4,Q8VDQ8
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Metabolic pathways
    Gene Ensembl ENSECAG00000023223, ENSMMUG00000023640, ENSG00000068903, ENSBTAG00000001776, ENSCAFG00845004895, ENSMUSG00000015149
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.