Human WRB/CHD5/GET1 ORF/cDNA clone-Lentivirus plasmid (NM_004627)

Cat. No.: pGMLP001284
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WRB/CHD5/GET1 Lentiviral expression plasmid for WRB lentivirus packaging, WRB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GET1/WRB/WRB/CHD5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $431.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001284
Gene Name WRB
Accession Number NM_004627
Gene ID 7485
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 525 bp
Gene Alias CHD5,GET1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCAGCCGCGGCCGACCACTGGGCGTGGTTGCTGGTGCTCAGCTTCGTGTTTGGATGCAATGTTCTTAGGATCCTCCTCCCGTCCTTCTCATCCTTCATGTCCAGGGTGCTGCAGAAGGACGCGGAGCAGGAGTCACAGATGAGAGCGGAGATCCAGGACATGAAGCAGGAGCTCTCCACAGTCAACATGATGGACGAGTTTGCCAGATATGCCAGGCTGGAAAGAAAGATCAACAAGATGACGGATAAGCTCAAAACCCATGTGAAAGCTCGGACAGCTCAATTAGCCAAGATAAAATGGGTGATAAGTGTCGCTTTCTACGTATTGCAGGCTGCCCTGATGATCTCACTCATTTGGAAGTATTATTCTGTCCCTGTGGCTGTCGTGCCGAGTAAATGGATAACCCCTCTAGACCGCCTGGTAGCCTTTCCTACTAGAGTAGCAGGTGGTGTTGGAATTACCTGTTGGATTTTAGTCTGTAACAAAGTTGTCGCTATTGTGCTTCATCCGTTCAGCTGA
ORF Protein Sequence MSSAAADHWAWLLVLSFVFGCNVLRILLPSFSSFMSRVLQKDAEQESQMRAEIQDMKQELSTVNMMDEFARYARLERKINKMTDKLKTHVKARTAQLAKIKWVISVAFYVLQAALMISLIWKYYSVPVAVVPSKWITPLDRLVAFPTRVAGGVGITCWILVCNKVVAIVLHPFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2281-Ab Anti-WRB monoclonal antibody
    Target Antigen GM-Tg-g-IP2281-Ag WRB protein
    ORF Viral Vector pGMLP001284 Human WRB Lentivirus plasmid
    ORF Viral Vector vGMLP001284 Human WRB Lentivirus particle


    Target information

    Target ID GM-IP2281
    Target Name GET1/WRB
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7485
    Gene ID 100059393 (Equus caballus), 101098734 (Felis catus), 106997239 (Macaca mulatta), 111093447 (Canis lupus familiaris)
    288233 (Rattus norvegicus), 509739 (Bos taurus), 71446 (Mus musculus), 7485 (Homo sapiens)
    Gene Symbols & Synonyms GET1,Get1,WRB,Wrb,Chd5,5530402J05Rik,C030018G21Rik,CHD5
    Target Alternative Names 5530402J05Rik,C030018G21Rik,CHD5,Chd5,Congenital heart disease 5 protein,GET1,Get1,Guided entry of tail-anchored proteins factor 1,Tail-anchored protein insertion receptor WRB,Tryptophan-rich basic protein,WRB,Wrb
    Uniprot Accession O00258,Q3SZ26,Q6P6S5,Q8K0D7
    Additional SwissProt Accessions: Q6P6S5,Q3SZ26,Q8K0D7,O00258
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000007859, ENSMMUG00000020654, ENSCAFG00845029628, ENSMUSG00000023147, ENSG00000182093
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.