Human GSTA1/GST-epsilon/GST2 ORF/cDNA clone-Lentivirus plasmid (NM_145740.4)
Cat. No.: pGMLP001199
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GSTA1/GST-epsilon/GST2 Lentiviral expression plasmid for GSTA1 lentivirus packaging, GSTA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GSTA1/GST-epsilon products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001199 |
Gene Name | GSTA1 |
Accession Number | NM_145740.4 |
Gene ID | 2938 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 669 bp |
Gene Alias | GST-epsilon,GST2,GSTA1-1,GTH1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCAGAGAAGCCCAAGCTCCACTACTTCAATGCACGGGGCAGAATGGAGTCCACCCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAGCTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAAGACATAAAGGAGAGAGCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGTGGAACTTCTCTACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGGAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTTTAA |
ORF Protein Sequence | MAEKPKLHYFNARGRMESTRWLLAAAGVEFEEKFIKSAEDLDKLRNDGYLMFQQVPMVEIDGMKLVQTRAILNYIASKYNLYGKDIKERALIDMYIEGIADLGEMILLLPVCPPEEKDAKLALIKEKIKNRYFPAFEKVLKSHGQDYLVGNKLSRADIHLVELLYYVEELDSSLISSFPLLKALKTRISNLPTVKKFLQPGSPRKPPMDEKSLEEARKIFRF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T17221-Ab | Anti-GSTA1 monoclonal antibody |
Target Antigen | GM-Tg-g-T17221-Ag | GSTA1 protein |
ORF Viral Vector | pGMLP001199 | Human GSTA1 Lentivirus plasmid |
ORF Viral Vector | pGMLP002281 | Human GSTA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001199 | Human GSTA1 Lentivirus particle |
ORF Viral Vector | vGMLP002281 | Human GSTA1 Lentivirus particle |
Target information
Target ID | GM-T17221 |
Target Name | GSTA1 |
Gene Group Identifier (Target Gene ID in Homo species) |
2938 |
Gene ID | 2938 (Homo sapiens) |
Gene Symbols & Synonyms | GSTA1,GST2,GTH1,GSTA1-1,GST-epsilon |
Target Alternative Names | GSTA1,Glutathione S-transferase A1,13-hydroperoxyoctadecadienoate peroxidase, Androst-5-ene-3,17-dione isomerase, GST HA subunit 1, GST class-alpha member 1, GST-epsilon, GSTA1-1, GTH1,GST2,GTH1,GSTA1-1,GST-epsilon |
Uniprot Accession |
P08263
Additional SwissProt Accessions: P08263 |
Uniprot Entry Name | |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | cancer, Prostate Cancer |
Disease from KEGG | Metabolic pathways, Pathways in cancer, Chemical carcinogenesis - DNA adducts, Chemical carcinogenesis - receptor activation, Hepatocellular carcinoma, Fluid shear stress and atherosclerosis, Drug metabolism - cytochrome P450 |
Gene Ensembl | ENSG00000243955 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.