Human TNFRSF18/AITR/CD357 ORF/cDNA clone-Lentivirus plasmid (NM_004195)

Cat. No.: pGMLP000991
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TNFRSF18/AITR/CD357 Lentiviral expression plasmid for TNFRSF18 lentivirus packaging, TNFRSF18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TNFRSF18/CD357/TNFRSF18/AITR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $481.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000991
Gene Name TNFRSF18
Accession Number NM_004195
Gene ID 8784
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 726 bp
Gene Alias AITR,CD357,GITR,GITR-D
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCACAGCACGGGGCGATGGGCGCGTTTCGGGCCCTGTGCGGCCTGGCGCTGCTGTGCGCGCTCAGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCCCTGGGCGCCTCCTGCTTGGGACGGGAACGGACGCGCGCTGCTGCCGGGTTCACACGACGCGCTGCTGCCGCGATTACCCGGGCGAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGCCTGAATTCCACTGCGGAGACCCTTGCTGCACGACCTGCCGGCACCACCCTTGTCCCCCAGGCCAGGGGGTACAGTCCCAGGGGAAATTCAGTTTTGGCTTCCAGTGTATCGACTGTGCCTCGGGGACCTTCTCCGGGGGCCACGAAGGCCACTGCAAACCTTGGACAGACTGCACCCAGTTCGGGTTTCTCACTGTGTTCCCTGGGAACAAGACCCACAACGCTGTGTGCGTCCCAGGGTCCCCGCCGGCAGAGCCGCTTGGGTGGCTGACCGTCGTCCTCCTGGCCGTGGCCGCCTGCGTCCTCCTCCTGACCTCGGCCCAGCTTGGACTGCACATCTGGCAGCTGAGGAGTCAGTGCATGTGGCCCCGAGAGACCCAGCTGCTGCTGGAGGTGCCGCCGTCGACCGAAGACGCCAGAAGCTGCCAGTTCCCCGAGGAAGAGCGGGGCGAGCGATCGGCAGAGGAGAAGGGGCGGCTGGGAGACCTGTGGGTGTGA
ORF Protein Sequence MAQHGAMGAFRALCGLALLCALSLGQRPTGGPGCGPGRLLLGTGTDARCCRVHTTRCCRDYPGEECCSEWDCMCVQPEFHCGDPCCTTCRHHPCPPGQGVQSQGKFSFGFQCIDCASGTFSGGHEGHCKPWTDCTQFGFLTVFPGNKTHNAVCVPGSPPAEPLGWLTVVLLAVAACVLLLTSAQLGLHIWQLRSQCMWPRETQLLLEVPPSTEDARSCQFPEEERGERSAEEKGRLGDLWV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-466 Pre-Made Ragifilimab biosimilar, Whole mAb, Anti-TNFRSF18 Antibody: Anti-AITR/CD357/ENERGEN/GITR/GITR-D therapeutic antibody
    Biosimilar GMP-Bios-INN-810 Pre-Made Efaprinermin Alfa Biosimilar, Fusion Protein targeting TNFRSF18 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AITR/CD357/ENERGEN/GITR/GITR-D
    Biosimilar GMP-Bios-INN-815 Pre-Made Efgivanermin Alfa Biosimilar, Fusion Protein targeting TNFRSF18 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AITR/CD357/ENERGEN/GITR/GITR-D
    Target Antibody GM-Tg-g-T15344-Ab Anti-TNR18/ TNFRSF18/ AITR monoclonal antibody
    Target Antigen GM-Tg-g-T15344-Ag TNFRSF18 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T15344 tumor necrosis factor receptor superfamily, member 18 (TNFRSF18) protein & antibody
    ORF Viral Vector pGMLP000991 Human TNFRSF18 Lentivirus plasmid
    ORF Viral Vector vGMLP000991 Human TNFRSF18 Lentivirus particle


    Target information

    Target ID GM-T15344
    Target Name TNFRSF18/CD357
    Gene Group Identifier
    (Target Gene ID in Homo species)
    8784
    Gene ID 100066195 (Equus caballus), 101083251 (Felis catus), 21936 (Mus musculus), 500598 (Rattus norvegicus)
    516256 (Bos taurus), 606971 (Canis lupus familiaris), 699559 (Macaca mulatta), 8784 (Homo sapiens)
    Gene Symbols & Synonyms TNFRSF18,Tnfrsf18,AITR,Gitr,GITR,CD357,GITR-D,ENERGEN
    Target Alternative Names AITR,Activation-inducible TNFR family receptor,CD357,ENERGEN,GITR,GITR-D,Gitr,Glucocorticoid-induced TNFR-related protein,TNFRSF18,Tnfrsf18,Tumor necrosis factor receptor superfamily member 18
    Uniprot Accession O35714,Q9Y5U5
    Additional SwissProt Accessions: O35714,Q9Y5U5
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction
    Gene Ensembl ENSMUSG00000041954, ENSBTAG00000015632, ENSCAFG00845022900, ENSMMUG00000014205, ENSG00000186891
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.