Human PIM2 ORF/cDNA clone-Lentivirus plasmid (NM_006875)

Cat. No.: pGMLP000986
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PIM2/ Lentiviral expression plasmid for PIM2 lentivirus packaging, PIM2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PIM2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $534
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000986
Gene Name PIM2
Accession Number NM_006875
Gene ID 11040
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 936 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGACCAAGCCTCTACAGGGGCCTCCCGCGCCCCCCGGGACCCCCACGCCGCCGCCAGGAGGCAAGGATCGGGAAGCGTTCGAGGCCGAGTATCGACTCGGCCCCCTCCTGGGTAAGGGGGGCTTTGGCACCGTCTTCGCAGGACACCGCCTCACAGATCGACTCCAGGTGGCCATCAAAGTGATTCCCCGGAATCGTGTGCTGGGCTGGTCCCCCTTGTCAGACTCAGTCACATGCCCACTCGAAGTCGCACTGCTATGGAAAGTGGGTGCAGGTGGTGGGCACCCTGGCGTGATCCGCCTGCTTGACTGGTTTGAGACACAGGAGGGCTTCATGCTGGTCCTCGAGCGGCCTTTGCCCGCCCAGGATCTCTTTGACTATATCACAGAGAAGGGCCCACTGGGTGAAGGCCCAAGCCGCTGCTTCTTTGGCCAAGTAGTGGCAGCCATCCAGCACTGCCATTCCCGTGGAGTTGTCCATCGTGACATCAAGGATGAGAACATCCTGATAGACCTACGCCGTGGCTGTGCCAAACTCATTGATTTTGGTTCTGGTGCCCTGCTTCATGATGAACCCTACACTGACTTTGATGGGACAAGGGTGTACAGCCCCCCAGAGTGGATCTCTCGACACCAGTACCATGCACTCCCGGCCACTGTCTGGTCACTGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAA
ORF Protein Sequence MLTKPLQGPPAPPGTPTPPPGGKDREAFEAEYRLGPLLGKGGFGTVFAGHRLTDRLQVAIKVIPRNRVLGWSPLSDSVTCPLEVALLWKVGAGGGHPGVIRLLDWFETQEGFMLVLERPLPAQDLFDYITEKGPLGEGPSRCFFGQVVAAIQHCHSRGVVHRDIKDENILIDLRRGCAKLIDFGSGALLHDEPYTDFDGTRVYSPPEWISRHQYHALPATVWSLGILLYDMVCGDIPFERDQEILEAELHFPAHVSPDCCALIRRCLAPKPSSRPSLEEILLDPWMQTPAEDVPLNPSKGGPAPLAWSLLP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0052-Ab Anti-PIM2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0052-Ag PIM2 protein
    ORF Viral Vector pGMLP000986 Human PIM2 Lentivirus plasmid
    ORF Viral Vector pGMLP005248 Human PIM2 Lentivirus plasmid
    ORF Viral Vector vGMLP000986 Human PIM2 Lentivirus particle
    ORF Viral Vector vGMLP005248 Human PIM2 Lentivirus particle


    Target information

    Target ID GM-IP0052
    Target Name PIM2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    11040
    Gene ID 100062483 (Equus caballus), 101098037 (Felis catus), 11040 (Homo sapiens), 18715 (Mus musculus)
    317366 (Rattus norvegicus), 442959 (Canis lupus familiaris), 508424 (Bos taurus), 711844 (Macaca mulatta)
    Gene Symbols & Synonyms PIM2,Pim2,Pim-2,DXCch3
    Target Alternative Names DXCch3,PIM2,Pim-2,Pim-2h,Pim2,Serine/threonine-protein kinase pim-2
    Uniprot Accession Q62070,Q9P1W9
    Additional SwissProt Accessions: Q9P1W9,Q62070
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Pathways in cancer, Acute myeloid leukemia
    Gene Ensembl ENSECAG00000007505, ENSG00000102096, ENSMUSG00000031155, ENSCAFG00845031001, ENSBTAG00000004597, ENSMMUG00000053345
    Target Classification Kinase


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.