Human M6PR/CD-M6PR/CD-MPR ORF/cDNA clone-Lentivirus plasmid (NM_002355)

Cat. No.: pGMLP000738
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human M6PR/CD-M6PR/CD-MPR Lentiviral expression plasmid for M6PR lentivirus packaging, M6PR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to M6PR/CD-M6PR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $508.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000738
Gene Name M6PR
Accession Number NM_002355
Gene ID 4074
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 834 bp
Gene Alias CD-M6PR,CD-MPR,MPR 46,MPR-46,MPR46,SMPR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTCCCTTTCTACAGCTGCTGGAGGACTGGACTGCTACTACTACTCCTGGCTGTGGCAGTGAGAGAATCCTGGCAGACAGAAGAAAAAACTTGCGACTTGGTAGGAGAAAAGGGTAAAGAGTCAGAGAAAGAGTTGGCTCTAGTGAAGAGGCTGAAACCACTGTTTAATAAAAGCTTTGAGAGCACTGTGGGCCAGGGTTCAGACACATACATCTACATCTTCAGGGTGTGCCGGGAAGCTGGCAACCACACTTCTGGGGCAGGCCTGGTGCAAATCAACAAAAGTAATGGGAAGGAGACAGTGGTAGGGAGACTCAACGAGACTCACATCTTCAACGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAACCACTGTGGCAAGGAGCAGCGTCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGTGGCAAAGTCCAAGATTGTTTCTACCTCTTTGAGATGGATAGCAGCCTGGCCTGTTCACCAGAGATCTCCCACCTCAGTGTGGGTTCCATCTTACTTGTCACGTTTGCATCACTGGTTGCTGTTTATGTTGTTGGGGGGTTCCTATACCAGCGACTGGTAGTGGGAGCCAAAGGAATGGAGCAGTTTCCCCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGCTGTGACTTTGTCTGCCGTTCTAAACCTCGAAATGTGCCTGCAGCATATCGTGGTGTGGGGGATGACCAGCTGGGGGAGGAGTCAGAAGAAAGGGATGACCATTTATTACCAATGTAG
ORF Protein Sequence MFPFYSCWRTGLLLLLLAVAVRESWQTEEKTCDLVGEKGKESEKELALVKRLKPLFNKSFESTVGQGSDTYIYIFRVCREAGNHTSGAGLVQINKSNGKETVVGRLNETHIFNGSNWIMLIYKGGDEYDNHCGKEQRRAVVMISCNRHTLADNFNPVSEERGKVQDCFYLFEMDSSLACSPEISHLSVGSILLVTFASLVAVYVVGGFLYQRLVVGAKGMEQFPHLAFWQDLGNLVADGCDFVCRSKPRNVPAAYRGVGDDQLGEESEERDDHLLPM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97174-Ab Anti-MPRD/ M6PR/ CD-M6PR monoclonal antibody
    Target Antigen GM-Tg-g-T97174-Ag M6PR VLP (virus-like particle)
    ORF Viral Vector pGMLP000738 Human M6PR Lentivirus plasmid
    ORF Viral Vector vGMLP000738 Human M6PR Lentivirus particle


    Target information

    Target ID GM-T97174
    Target Name M6PR
    Gene Group Identifier
    （Target Gene ID in Homo species)         		4074
    Gene ID 100061559 (Equus caballus), 101098389 (Felis catus), 17113 (Mus musculus), 281291 (Bos taurus)
    312689 (Rattus norvegicus), 4074 (Homo sapiens), 477700 (Canis lupus familiaris), 716696 (Macaca mulatta)
    Gene Symbols & Synonyms M6PR,M6pr,Mpr46,CD-MPR,CDMPR,SMPR,MPR46,MPR 46,MPR-46,CD-M6PR
    Target Alternative Names M6PR,Cation-dependent mannose-6-phosphate receptor,CD Man-6-P receptor, CD-MPR,46 kDa mannose 6-phosphate receptor (MPR 46),SMPR,MPR46,CD-MPR,MPR 46,MPR-46,CD-M6PR
    Uniprot Accession P11456,P20645,P24668,Q6AY20
    Additional SwissProt Accessions: P24668,P11456,Q6AY20,P20645
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Lysosome, Phagosome
    Gene Ensembl ENSECAG00000021995, ENSMUSG00000007458, ENSBTAG00000018207, ENSG00000003056, ENSCAFG00845028694, ENSMMUG00000017846
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.