Human GREM1/C15DUPq/CKTSF1B1 ORF/cDNA clone-Lentivirus plasmid (NM_013372)
Cat. No.: pGMLP000730
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GREM1/C15DUPq/CKTSF1B1 Lentiviral expression plasmid for GREM1 lentivirus packaging, GREM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GREM1/Gremlin-1/GREM1/C15DUPq products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000730 |
Gene Name | GREM1 |
Accession Number | NM_013372 |
Gene ID | 26585 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 555 bp |
Gene Alias | C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,GREMLIN,HMPS,HMPS1,IHG-2,MPSH,PIG2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCCGCACAGCCTACACGGTGGGAGCCCTGCTTCTCCTCTTGGGGACCCTGCTGCCGGCTGCTGAAGGGAAAAAGAAAGGGTCCCAAGGTGCCATCCCCCCGCCAGACAAGGCCCAGCACAATGACTCAGAGCAGACTCAGTCGCCCCAGCAGCCTGGCTCCAGGAACCGGGGGCGGGGCCAAGGGCGGGGCACTGCCATGCCCGGGGAGGAGGTGCTGGAGTCCAGCCAAGAGGCCCTGCATGTGACGGAGCGCAAATACCTGAAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAA |
ORF Protein Sequence | MSRTAYTVGALLLLLGTLLPAAEGKKKGSQGAIPPPDKAQHNDSEQTQSPQQPGSRNRGRGQGRGTAMPGEEVLESSQEALHVTERKYLKRDWCKTQPLKQTIHEEGCNSRTIINRFCYGQCNSFYIPRHIRKEEGSFQSCSFCKPKKFTTMMVTLNCPELQPPTKKKRVTRVKQCRCISIDLD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-669 | Pre-Made Ginisortamab biosimilar, Whole mAb, Anti-GREM1/Gremlin-1 Antibody: Anti-C15DUPq/CKTSF1B1/CRAC1/CRCS4/DAND2/DRM/DUP15q/GREMLIN/HMPS/HMPS1/IHG-2/MPSH/PIG2 therapeutic antibody |
Target Antibody | GM-Tg-g-T22104-Ab | Anti-GREM1/ Gremlin-1/ C15DUPq functional antibody |
Target Antigen | GM-Tg-g-T22104-Ag | Gremlin-1/GREM1 protein |
ORF Viral Vector | pGMLP000730 | Human GREM1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000730 | Human GREM1 Adenovirus plasmid |
ORF Viral Vector | vGMLP000730 | Human GREM1 Lentivirus particle |
ORF Viral Vector | vGMAD000730 | Human GREM1 Adenovirus particle |
Target information
Target ID | GM-T22104 |
Target Name | GREM1/Gremlin-1 |
Gene Group Identifier (Target Gene ID in Homo species) |
26585 |
Gene ID |
100057765 (Equus caballus), 101096735 (Felis catus), 23892 (Mus musculus), 26585 (Homo sapiens) 487475 (Canis lupus familiaris), 50566 (Rattus norvegicus), 539079 (Bos taurus), 574176 (Macaca mulatta) |
Gene Symbols & Synonyms | GREM1,Grem1,ld,Drm,Grem,Cktsf1b1,DRM,HMPS,MPSH,PIG2,CRAC1,CRCS4,DAND2,HMPS1,IHG-2,DUP15q,C15DUPq,GREMLIN,CKTSF1B1,drm,gremlin-1 |
Target Alternative Names | BMP antagonist 1,C15DUPq,CKTSF1B1,CRAC1,CRCS4,Cell proliferation-inducing gene 2 protein,Cktsf1b1,Cysteine knot superfamily 1,DAN domain family member 2,DAND2,DRM,DUP15q,Down-regulated in Mos-transformed cells protein,Drm,GREM1,GREMLIN,Grem,Grem1,Gremlin-1,HMPS,HMPS1,IHG-2,Increased in high glucose protein 2 (IHG-2),MPSH,PIG2,drm,gremlin-1,ld |
Uniprot Accession |
O35793,O60565,O70326,Q8WNY1
Additional SwissProt Accessions: O70326,O60565,O35793,Q8WNY1 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index |
Disease | cancer |
Disease from KEGG | TGF-beta signaling pathway |
Gene Ensembl | ENSECAG00000044796, ENSMUSG00000074934, ENSG00000166923, ENSBTAG00000050495, ENSMMUG00000001810 |
Target Classification | Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.