Human GREM1/C15DUPq/CKTSF1B1 ORF/cDNA clone-Lentivirus plasmid (NM_013372)

Cat. No.: pGMLP000730
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GREM1/C15DUPq/CKTSF1B1 Lentiviral expression plasmid for GREM1 lentivirus packaging, GREM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GREM1/Gremlin-1/GREM1/C15DUPq products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $438.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000730
Gene Name GREM1
Accession Number NM_013372
Gene ID 26585
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,GREMLIN,HMPS,HMPS1,IHG-2,MPSH,PIG2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCCGCACAGCCTACACGGTGGGAGCCCTGCTTCTCCTCTTGGGGACCCTGCTGCCGGCTGCTGAAGGGAAAAAGAAAGGGTCCCAAGGTGCCATCCCCCCGCCAGACAAGGCCCAGCACAATGACTCAGAGCAGACTCAGTCGCCCCAGCAGCCTGGCTCCAGGAACCGGGGGCGGGGCCAAGGGCGGGGCACTGCCATGCCCGGGGAGGAGGTGCTGGAGTCCAGCCAAGAGGCCCTGCATGTGACGGAGCGCAAATACCTGAAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAA
ORF Protein Sequence MSRTAYTVGALLLLLGTLLPAAEGKKKGSQGAIPPPDKAQHNDSEQTQSPQQPGSRNRGRGQGRGTAMPGEEVLESSQEALHVTERKYLKRDWCKTQPLKQTIHEEGCNSRTIINRFCYGQCNSFYIPRHIRKEEGSFQSCSFCKPKKFTTMMVTLNCPELQPPTKKKRVTRVKQCRCISIDLD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-669 Pre-Made Ginisortamab biosimilar, Whole mAb, Anti-GREM1/Gremlin-1 Antibody: Anti-C15DUPq/CKTSF1B1/CRAC1/CRCS4/DAND2/DRM/DUP15q/GREMLIN/HMPS/HMPS1/IHG-2/MPSH/PIG2 therapeutic antibody
    Target Antibody GM-Tg-g-T22104-Ab Anti-GREM1/ Gremlin-1/ C15DUPq functional antibody
    Target Antigen GM-Tg-g-T22104-Ag Gremlin-1/GREM1 protein
    ORF Viral Vector pGMLP000730 Human GREM1 Lentivirus plasmid
    ORF Viral Vector pGMAD000730 Human GREM1 Adenovirus plasmid
    ORF Viral Vector vGMLP000730 Human GREM1 Lentivirus particle
    ORF Viral Vector vGMAD000730 Human GREM1 Adenovirus particle


    Target information

    Target ID GM-T22104
    Target Name GREM1/Gremlin-1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    26585
    Gene ID 100057765 (Equus caballus), 101096735 (Felis catus), 23892 (Mus musculus), 26585 (Homo sapiens)
    487475 (Canis lupus familiaris), 50566 (Rattus norvegicus), 539079 (Bos taurus), 574176 (Macaca mulatta)
    Gene Symbols & Synonyms GREM1,Grem1,ld,Drm,Grem,Cktsf1b1,DRM,HMPS,MPSH,PIG2,CRAC1,CRCS4,DAND2,HMPS1,IHG-2,DUP15q,C15DUPq,GREMLIN,CKTSF1B1,drm,gremlin-1
    Target Alternative Names BMP antagonist 1,C15DUPq,CKTSF1B1,CRAC1,CRCS4,Cell proliferation-inducing gene 2 protein,Cktsf1b1,Cysteine knot superfamily 1,DAN domain family member 2,DAND2,DRM,DUP15q,Down-regulated in Mos-transformed cells protein,Drm,GREM1,GREMLIN,Grem,Grem1,Gremlin-1,HMPS,HMPS1,IHG-2,Increased in high glucose protein 2 (IHG-2),MPSH,PIG2,drm,gremlin-1,ld
    Uniprot Accession O35793,O60565,O70326,Q8WNY1
    Additional SwissProt Accessions: O70326,O60565,O35793,Q8WNY1
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease cancer
    Disease from KEGG TGF-beta signaling pathway
    Gene Ensembl ENSECAG00000044796, ENSMUSG00000074934, ENSG00000166923, ENSBTAG00000050495, ENSMMUG00000001810
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.