Human KLRC1/CD159A/NKG2 ORF/cDNA clone-Lentivirus plasmid (NM_213658)

Cat. No.: pGMLP000727
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KLRC1/CD159A/NKG2 Lentiviral expression plasmid for KLRC1 lentivirus packaging, KLRC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to NKG2A/KLRC1/CD159a/KLRC1/CD159A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $475.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000727
Gene Name KLRC1
Accession Number NM_213658
Gene ID 3821
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 702 bp
Gene Alias CD159A,NKG2,NKG2A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATAACCAAGGAGTAATCTACTCAGACCTGAATCTGCCCCCAAACCCAAAGAGGCAGCAACGAAAACCTAAAGGCAATAAAAACTCCATTTTAGCAACTGAACAGGAAATAACCTATGCGGAATTAAACCTTCAAAAAGCTTCTCAGGATTTTCAAGGGAATGACAAAACCTATCACTGCAAAGATTTACCATCAGCTCCAGAGAAGCTCATTGTTGGGATCCTGGGAATTATCTGTCTTATCTTAATGGCCTCTGTGGTAACGATAGTTGTTATTCCCTCTACATTAATACAGAGGCACAACAATTCTTCCCTGAATACAAGAACTCAGAAAGCACGTCATTGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTACTACATTGGTAAGGAAAGAAGAACTTGGGAAGAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAAGAAATGAAATTTCTGTCCATCATTTCACCATCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGTGACAATGAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATAATGCTGAACTTAACTGTGCAGTGCTACAAGTAAATCGACTTAAATCAGCCCAGTGTGGATCTTCAATAATATATCATTGTAAGCATAAGCTTTAG
ORF Protein Sequence MDNQGVIYSDLNLPPNPKRQQRKPKGNKNSILATEQEITYAELNLQKASQDFQGNDKTYHCKDLPSAPEKLIVGILGIICLILMASVVTIVVIPSTLIQRHNNSSLNTRTQKARHCGHCPEEWITYSNSCYYIGKERRTWEESLLACTSKNSSLLSIDNEEEMKFLSIISPSSWIGVFRNSSHHPWVTMNGLAFKHEIKDSDNAELNCAVLQVNRLKSAQCGSSIIYHCKHKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-355 Pre-Made Monalizumab biosimilar, Whole mAb, Anti-KLRC1/NKG2A Antibody: Anti-CD159A/NKG2 therapeutic antibody
    Target Antibody GM-Tg-g-T15783-Ab Anti-NKG2A/ KLRC1/ CD159A monoclonal antibody
    Target Antigen GM-Tg-g-T15783-Ag NKG2A/KLRC1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000727 Human KLRC1 Lentivirus plasmid
    ORF Viral Vector vGMLP000727 Human KLRC1 Lentivirus particle


    Target information

    Target ID GM-T15783
    Target Name NKG2A/KLRC1/CD159a
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3821
    Gene ID 29683 (Rattus norvegicus), 3821 (Homo sapiens), 574146 (Macaca mulatta)
    Gene Symbols & Synonyms Klrc1,KLRC1,rNKG2A,NKG2,NKG2A,CD159A,CD159a,NKG2-A
    Target Alternative Names CD159 antigen-like family member A,CD159A,CD159a,KLRC1,Klrc1,NK cell receptor A,NKG2,NKG2-A,NKG2-A/B-activating NK receptor,NKG2-A/NKG2-B type II integral membrane protein,NKG2A,rNKG2A
    Uniprot Accession P26715,Q9MZJ3
    Additional SwissProt Accessions: P26715,Q9MZJ3
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease
    Disease from KEGG Antigen processing and presentation, Natural killer cell mediated cytotoxicity, Graft-versus-host disease
    Gene Ensembl ENSG00000134545
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.