Human SOSTDC1/CDA019/DAND7 ORF/cDNA clone-Lentivirus plasmid (NM_015464)

Cat. No.: pGMLP000702
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SOSTDC1/CDA019/DAND7 Lentiviral expression plasmid for SOSTDC1 lentivirus packaging, SOSTDC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SOSTDC1/CDA019 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $455.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000702
Gene Name SOSTDC1
Accession Number NM_015464
Gene ID 25928
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 621 bp
Gene Alias CDA019,DAND7,ECTODIN,USAG1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTTCCTCCTGCCATTCATTTCTATCTCCTTCCCCTTGCATGCATCCTAATGAAAAGCTGTTTGGCTTTTAAAAATGATGCCACAGAAATCCTTTATTCACATGTGGTTAAACCTGTTCCAGCACACCCCAGCAGCAACAGCACGTTGAATCAAGCCAGAAATGGAGGCAGGCATTTCAGTAACACTGGACTGGATCGGAACACTCGGGTTCAAGTGGGTTGCCGGGAACTGCGTTCCACCAAATACATCTCTGATGGCCAGTGCACCAGCATCAGCCCTCTGAAGGAGCTGGTGTGTGCTGGCGAGTGCTTGCCCCTGCCAGTGCTCCCTAACTGGATTGGAGGAGGCTATGGAACAAAGTACTGGAGCAGGAGGAGCTCCCAGGAGTGGCGGTGTGTCAATGACAAAACCCGTACCCAGAGAATCCAGCTGCAGTGCCAAGATGGCAGCACACGCACCTACAAAATCACAGTAGTCACTGCCTGCAAGTGCAAGAGGTACACCCGGCAGCACAACGAGTCCAGTCACAACTTTGAGAGCATGTCACCTGCCAAGCCAGTCCAGCATCACAGAGAGCGGAAAAGAGCCAGCAAATCCAGCAAGCACAGCATGAGTTAG
ORF Protein Sequence MLPPAIHFYLLPLACILMKSCLAFKNDATEILYSHVVKPVPAHPSSNSTLNQARNGGRHFSNTGLDRNTRVQVGCRELRSTKYISDGQCTSISPLKELVCAGECLPLPVLPNWIGGGYGTKYWSRRSSQEWRCVNDKTRTQRIQLQCQDGSTRTYKITVVTACKCKRYTRQHNESSHNFESMSPAKPVQHHRERKRASKSSKHSMS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1301-Ab Anti-SOSD1/ SOSTDC1/ CDA019 functional antibody
    Target Antigen GM-Tg-g-SE1301-Ag SOSTDC1 protein
    ORF Viral Vector pGMLP000702 Human SOSTDC1 Lentivirus plasmid
    ORF Viral Vector vGMLP000702 Human SOSTDC1 Lentivirus particle


    Target information

    Target ID GM-SE1301
    Target Name SOSTDC1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    25928
    Gene ID 100052877 (Equus caballus), 101083758 (Felis catus), 102152602 (Canis lupus familiaris), 25928 (Homo sapiens)
    266803 (Rattus norvegicus), 523184 (Bos taurus), 66042 (Mus musculus), 709577 (Macaca mulatta)
    Gene Symbols & Synonyms SOSTDC1,Sostdc1,DAND7,USAG1,CDA019,ECTODIN,Wise,Usag1,Usag-1,Sostl,USAG-1,ectodin,0610006G05Rik
    Target Alternative Names SOSTDC1,Sclerostin domain-containing protein 1,Ectodermal BMP inhibitor (Ectodin), Uterine sensitization-associated gene 1 protein (USAG-1),DAND7,USAG1,CDA019,ECTODIN
    Uniprot Accession Q642G2,Q6X4U4,Q9CQN4
    Additional SwissProt Accessions: Q6X4U4,Q642G2,Q9CQN4
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000012109, ENSCAFG00845005605, ENSG00000171243, ENSBTAG00000005377, ENSMUSG00000036169, ENSMMUG00000016817
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.