Human FABP4/A-FABP/AFABP ORF/cDNA clone-Lentivirus plasmid (NM_001442)

Cat. No.: pGMLP000634
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FABP4/A-FABP/AFABP Lentiviral expression plasmid for FABP4 lentivirus packaging, FABP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FABP4/A-FABP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000634
Gene Name FABP4
Accession Number NM_001442
Gene ID 2167
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 399 bp
Gene Alias A-FABP,AFABP,ALBP,aP2,HEL-S-104
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAA
ORF Protein Sequence MCDAFVGTWKLVSSENFDDYMKEVGVGFATRKVAGMAKPNMIISVNGDVITIKSESTFKNTEISFILGQEFDEVTADDRKVKSTITLDGGVLVHVQKWDGKSTTIKRKREDDKLVVECVMKGVTSTRVYERA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T07217-Ab Anti-FABP4 monoclonal antibody
    Target Antigen GM-Tg-g-T07217-Ag FABP4 protein
    ORF Viral Vector pGMLP000634 Human FABP4 Lentivirus plasmid
    ORF Viral Vector pGMPC000894 Human FABP4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000634 Human FABP4 Lentivirus particle


    Target information

    Target ID GM-T07217
    Target Name FABP4
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2167
    Gene ID 101087449 (Felis catus), 11770 (Mus musculus), 2167 (Homo sapiens), 608476 (Canis lupus familiaris)
    701365 (Macaca mulatta), 79451 (Rattus norvegicus)
    Gene Symbols & Synonyms FABP4,Fabp4,Ap2,P15,ALBP,Lbpl,AFABP,422/aP2,ALBP/Ap2,aP2,A-FABP,HEL-S-104,Albp
    Target Alternative Names 422/aP2,A-FABP,AFABP,AFABP),ALBP,ALBP/Ap2,Adipocyte lipid-binding protein (ALBP),Adipocyte-type fatty acid-binding protein (A-FABP,Albp,Ap2,FABP4,Fabp4,Fatty acid-binding protein,Fatty acid-binding protein 4,HEL-S-104,Lbpl,P15,aP2,adipocyte
    Uniprot Accession P04117,P15090,P70623
    Additional SwissProt Accessions: P04117,P15090,P70623
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Bladder Cell Carcinomas
    Disease from KEGG PPAR signaling pathway, Regulation of lipolysis in adipocytes
    Gene Ensembl ENSMUSG00000062515, ENSG00000170323, ENSCAFG00845014963, ENSMMUG00000020987
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.