Human CLN6/CLN4A/HsT18960 ORF/cDNA clone-Lentivirus plasmid (NM_017882.2)

Cat. No.: pGMLP000577
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLN6/CLN4A/HsT18960 Lentiviral expression plasmid for CLN6 lentivirus packaging, CLN6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CLN6/CLN4A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $534
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000577
Gene Name CLN6
Accession Number NM_017882.2
Gene ID 54982
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 936 bp
Gene Alias CLN4A,HsT18960,nclf
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCGACGCGGAGGCGGCAGCACCTGGGAGCGACGGGCGGCCCAGGCGCGCAGCTGGGCGCCTCCTTCCTGCAGGCCAGGCATGGCTCTGTGAGCGCTGATGAGGCTGCCCGCACGGCTCCCTTCCACCTCGACCTCTGGTTCTACTTCACACTGCAGAACTGGGTTCTGGACTTTGGGCGTCCCATTGCCATGCTGGTATTCCCTCTCGAGTGGTTTCCACTCAACAAGCCCAGTGTTGGGGACTACTTCCACATGGCCTACAACGTCATCACGCCCTTTCTCTTGCTCAAGCTCATCGAGCGGTCCCCCCGCACCCTGCCACGCTCCATCACGTACGTGAGCATCATCATCTTCATCATGGGTGCCAGCATCCACCTGGTGGGTGACTCTGTCAACCACCGCCTGCTCTTCAGTGGCTACCAGCACCACCTGTCTGTCCGTGAGAACCCCATCATCAAGAATCTCAAGCCGGAGACGCTGATCGACTCCTTTGAGCTGCTCTACTATTATGATGAGTACCTGGGTCACTGCATGTGGTACATCCCCTTCTTCCTCATCCTCTTCATGTACTTCAGCGGCTGCTTTACTGCCTCTAAAGCTGAGAGCTTGATTCCAGGGCCTGCCCTGCTCCTGGTGGCACCCAGTGGCCTGTACTACTGGTACCTGGTCACCGAGGGCCAGATCTTCATCCTCTTCATCTTCACCTTCTTCGCCATGCTGGCCCTCGTCCTGCACCAGAAGCGCAAGCGCCTCTTCCTGGACAGCAACGGCCTCTTCCTCTTCTCCTCCTTCGCACTGACCCTCTTGCTTGTGGCGCTCTGGGTCGCCTGGCTGTGGAATGACCCTGTTCTCAGGAAGAAGTACCCGGGTGTCATCTACGTCCCTGAGCCCTGGGCTTTCTACACCCTTCACGTCAGCAGTCGGCACTGA
ORF Protein Sequence MEATRRRQHLGATGGPGAQLGASFLQARHGSVSADEAARTAPFHLDLWFYFTLQNWVLDFGRPIAMLVFPLEWFPLNKPSVGDYFHMAYNVITPFLLLKLIERSPRTLPRSITYVSIIIFIMGASIHLVGDSVNHRLLFSGYQHHLSVRENPIIKNLKPETLIDSFELLYYYDEYLGHCMWYIPFFLILFMYFSGCFTASKAESLIPGPALLLVAPSGLYYWYLVTEGQIFILFIFTFFAMLALVLHQKRKRLFLDSNGLFLFSSFALTLLLVALWVAWLWNDPVLRKKYPGVIYVPEPWAFYTLHVSSRH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0562-Ab Anti-CLN6 monoclonal antibody
    Target Antigen GM-Tg-g-IP0562-Ag CLN6 protein
    ORF Viral Vector pGMLP000577 Human CLN6 Lentivirus plasmid
    ORF Viral Vector vGMLP000577 Human CLN6 Lentivirus particle


    Target information

    Target ID GM-IP0562
    Target Name CLN6
    Gene Group Identifier
    （Target Gene ID in Homo species)         		54982
    Gene ID 100065359 (Equus caballus), 101099969 (Felis catus), 315746 (Rattus norvegicus), 497068 (Canis lupus familiaris)
    54982 (Homo sapiens), 617615 (Bos taurus), 693873 (Macaca mulatta), 76524 (Mus musculus)
    Gene Symbols & Synonyms CLN6,Cln6,nclf,CLN4A,CLN6A,HsT18960,D9Bwg1455e,1810065L06Rik
    Target Alternative Names 1810065L06Rik,CLN4A,CLN6,CLN6A,Ceroid-lipofuscinosis neuronal protein 6,Cln6,D9Bwg1455e,HsT18960,Protein CLN6,nclf
    Uniprot Accession Q5JZQ8,Q9NWW5
    Additional SwissProt Accessions: Q5JZQ8,Q9NWW5
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000016991, ENSCAFG00845018935, ENSG00000128973, ENSBTAG00000005565, ENSMMUG00000011703, ENSMUSG00000032245
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.