Human IGFBP5/IBP5 ORF/cDNA clone-Lentivirus plasmid (NM_000599)

Cat. No.: pGMLP000569
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IGFBP5/IBP5 Lentiviral expression plasmid for IGFBP5 lentivirus packaging, IGFBP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IGFBP5/IBP5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $504.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000569
Gene Name IGFBP5
Accession Number NM_000599
Gene ID 3488
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 819 bp
Gene Alias IBP5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGTTGCTCACCGCGGTCCTCCTGCTGCTGGCCGCCTATGCGGGGCCGGCCCAGAGCCTGGGCTCCTTCGTGCACTGCGAGCCCTGCGACGAGAAAGCCCTCTCCATGTGCCCCCCCAGCCCCCTGGGCTGCGAGCTGGTCAAGGAGCCGGGCTGCGGCTGCTGCATGACCTGCGCCCTGGCCGAGGGGCAGTCGTGCGGCGTCTACACCGAGCGCTGCGCCCAGGGGCTGCGCTGCCTCCCCCGGCAGGACGAGGAGAAGCCGCTGCACGCCCTGCTGCACGGCCGCGGGGTTTGCCTCAACGAAAAGAGCTACCGCGAGCAAGTCAAGATCGAGAGAGACTCCCGTGAGCACGAGGAGCCCACCACCTCTGAGATGGCCGAGGAGACCTACTCCCCCAAGATCTTCCGGCCCAAACACACCCGCATCTCCGAGCTGAAGGCTGAAGCAGTGAAGAAGGACCGCAGAAAGAAGCTGACCCAGTCCAAGTTTGTCGGGGGAGCCGAGAACACTGCCCACCCCCGGATCATCTCTGCACCTGAGATGAGACAGGAGTCTGAGCAGGGCCCCTGCCGCAGACACATGGAGGCTTCCCTGCAGGAGCTCAAAGCCAGCCCACGCATGGTGCCCCGTGCTGTGTACCTGCCCAATTGTGACCGCAAAGGATTCTACAAGAGAAAGCAGTGCAAACCTTCCCGTGGCCGCAAACGTGGCATCTGCTGGTGCGTGGACAAGTACGGGATGAAGCTGCCAGGCATGGAGTACGTTGACGGGGACTTTCAGTGCCACACCTTCGACAGCAGCAACGTTGAGTGA
ORF Protein Sequence MVLLTAVLLLLAAYAGPAQSLGSFVHCEPCDEKALSMCPPSPLGCELVKEPGCGCCMTCALAEGQSCGVYTERCAQGLRCLPRQDEEKPLHALLHGRGVCLNEKSYREQVKIERDSREHEEPTTSEMAEETYSPKIFRPKHTRISELKAEAVKKDRRKKLTQSKFVGGAENTAHPRIISAPEMRQESEQGPCRRHMEASLQELKASPRMVPRAVYLPNCDRKGFYKRKQCKPSRGRKRGICWCVDKYGMKLPGMEYVDGDFQCHTFDSSNVE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0987-Ab Anti-IBP5/ IGFBP5 functional antibody
    Target Antigen GM-Tg-g-SE0987-Ag IGFBP5 protein
    Cytokine cks-Tg-g-GM-SE0987 insulin-like growth factor binding protein 5 (IGFBP5) protein & antibody
    ORF Viral Vector pGMLP000569 Human IGFBP5 Lentivirus plasmid
    ORF Viral Vector pGMAD001653 Human IGFBP5 Adenovirus plasmid
    ORF Viral Vector vGMLP000569 Human IGFBP5 Lentivirus particle
    ORF Viral Vector vGMAD001653 Human IGFBP5 Adenovirus particle


    Target information

    Target ID GM-SE0987
    Target Name IGFBP5
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3488
    Gene ID 100034063 (Equus caballus), 101084305 (Felis catus), 16011 (Mus musculus), 25285 (Rattus norvegicus)
    3488 (Homo sapiens), 404185 (Bos taurus), 610316 (Canis lupus familiaris), 696339 (Macaca mulatta)
    Gene Symbols & Synonyms IGFBP5,Igfbp5,IGFBP-5,IGFBP-5P,IGF-BP5,IBP5
    Target Alternative Names IBP-5,IBP5,IGF-BP5,IGF-binding protein 5,IGFBP-5,IGFBP-5P,IGFBP5,Igfbp5,Insulin-like growth factor-binding protein 5
    Uniprot Accession P24593,P24594,Q05717,Q07079
    Additional SwissProt Accessions: Q07079,P24594,P24593,Q05717
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease cancer, Breast Cancer, Dent disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000013425, ENSMUSG00000026185, ENSG00000115461, ENSBTAG00000059978, ENSCAFG00845024936, ENSMMUG00000041480
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.