Human MAPK9/JNK-55/JNK2 ORF/cDNA clone-Lentivirus plasmid (NM_002752)

Cat. No.: pGMLP000516
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPK9/JNK-55/JNK2 Lentiviral expression plasmid for MAPK9 lentivirus packaging, MAPK9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to JNK/MAPK9/JNK2/MAPK9/JNK-55 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $657
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000516
Gene Name MAPK9
Accession Number NM_002752
Gene ID 5601
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1275 bp
Gene Alias JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTCACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTTTGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCTTTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTCAATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAATTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCACATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAACATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAATCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTCATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATGGGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAAGGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAGCTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTCGAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTCCCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAAATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATACATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCCCAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTCATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCAGTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCCACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTTGAAGGCTGTCGATGA
ORF Protein Sequence MSDSKCDSQFYSVQVADSTFTVLKRYQQLKPIGSGAQGIVCAAFDTVLGINVAVKKLSRPFQNQTHAKRAYRELVLLKCVNHKNIISLLNVFTPQKTLEEFQDVYLVMELMDANLCQVIHMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTACTNFMMTPYVVTRYYRAPEVILGMGYKENVDIWSVGCIMGELVKGCVIFQGTDHIDQWNKVIEQLGTPSAEFMKKLQPTVRNYVENRPKYPGIKFEELFPDWIFPSESERDKIKTSQARDLLSKMLVIDPDKRISVDEALRHPYITVWYDPAEAEAPPPQIYDAQLEEREHAIEEWKELIYKEVMDWEERSKNGVVKDQPSDAAVSSNATPSQSSSINDISSMSTEQTLASDTDSSLDASTGPLEGCR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69375-Ab Anti-JNK2 monoclonal antibody
    Target Antigen GM-Tg-g-T69375-Ag JNK2/MAPK9 protein
    ORF Viral Vector pGMLP000516 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMLP005803 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMAP000176 Human MAPK9 Adenovirus plasmid
    ORF Viral Vector vGMLP000516 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMLP005803 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMAP000176 Human MAPK9 Adenovirus particle


    Target information

    Target ID GM-T69375
    Target Name JNK/MAPK9/JNK2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5601
    Gene ID 100057961 (Equus caballus), 101084765 (Felis catus), 26420 (Mus musculus), 474652 (Canis lupus familiaris)
    50658 (Rattus norvegicus), 534125 (Bos taurus), 5601 (Homo sapiens), 715782 (Macaca mulatta)
    Gene Symbols & Synonyms MAPK9,Mapk9,JNK2,Prkm9,p54aSAPK,SAPK,p54a,JNK2A,JNK2B,PRKM9,JNK-55,SAPK1a,JNK2BETA,JNK2ALPHA
    Target Alternative Names JNK, MAPK9, JNK2,Mitogen-activated protein kinase 9,MAP kinase 9, MAPK 9,JNK-55, Stress-activated protein kinase 1a (SAPK1a), Stress-activated protein kinase JNK2, c-Jun N-terminal kinase 2,JNK2,SAPK,p54a,JNK2A,JNK2B,PRKM9,JNK-55,SAPK1a,JNK2BETA,p54aSAPK,JNK2ALPHA
    Uniprot Accession P45984,P49186,Q9WTU6
    Additional SwissProt Accessions: Q9WTU6,P49186,P45984
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, cAMP signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Protein processing in endoplasmic reticulum, Apoptosis, Apoptosis - multiple species, Wnt signaling pathway, Osteoclast differentiation, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, C-type lectin receptor signaling pathway, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Neurotrophin signaling pathway, Inflammatory mediator regulation of TRP channels, GnRH signaling pathway, Prolactin signaling pathway, Adipocytokine signaling pathway, Relaxin signaling pathway, Type II diabetes mellitus, Insulin resistance, AGE-RAGE signaling pathway in diabetic complications, Growth hormone synthesis, secretion and action, Alcoholic liver disease, Alzheimer disease, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pertussis, Yersinia infection, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis B, Measles, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Choline metabolism in cancer, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSECAG00000021489, ENSMUSG00000020366, ENSCAFG00845006710, ENSBTAG00000004709, ENSG00000050748, ENSMMUG00000001728
    Target Classification Kinase


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.