Human SUV39H1/H3-K9-HMTase 1/KMT1A ORF/cDNA clone-Lentivirus plasmid (NM_003173)

Cat. No.: pGMLP000110
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SUV39H1/H3-K9-HMTase 1/KMT1A Lentiviral expression plasmid for SUV39H1 lentivirus packaging, SUV39H1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SUV39H1/H3-K9-HMTase 1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $646.92
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000110
Gene Name SUV39H1
Accession Number NM_003173
Gene ID 6839
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1239 bp
Gene Alias H3-K9-HMTase 1,KMT1A,MG44,SUV39H
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAAAATTTAAAAGGCTGCAGCGTGTGTTGCAAGTCTTCTTGGAATCAGCTGCAGGACCTGTGCCGCCTGGCCAAGCTCTCCTGCCCTGCCCTCGGTATCTCTAAGAGGAACCTCTATGACTTTGAAGTCGAGTACCTGTGCGATTACAAGAAGATCCGCGAACAGGAATATTACCTGGTGAAATGGCGTGGATATCCAGACTCAGAGAGCACCTGGGAGCCACGGCAGAATCTCAAGTGTGTGCGTATCCTCAAGCAGTTCCACAAGGACTTAGAAAGGGAGCTGCTCCGGCGGCACCACCGGTCAAAGACCCCCCGGCACCTGGACCCAAGCTTGGCCAACTACCTGGTGCAGAAGGCCAAGCAGAGGCGGGCGCTCCGTCGCTGGGAGCAGGAGCTCAATGCCAAGCGCAGCCATCTGGGACGCATCACTGTAGAGAATGAGGTGGACCTGGACGGCCCTCCGCGGGCCTTCGTGTACATCAATGAGTACCGTGTTGGTGAGGGCATCACCCTCAACCAGGTGGCTGTGGGCTGCGAGTGCCAGGACTGTCTGTGGGCACCCACTGGAGGCTGCTGCCCGGGGGCGTCACTGCACAAGTTTGCCTACAATGACCAGGGCCAGGTGCGGCTTCGAGCCGGGCTGCCCATCTACGAGTGCAACTCCCGCTGCCGCTGCGGCTATGACTGCCCAAATCGTGTGGTACAGAAGGGTATCCGATATGACCTCTGCATCTTCCGCACGGATGATGGGCGTGGCTGGGGCGTCCGCACCCTGGAGAAGATTCGCAAGAACAGCTTCGTCATGGAGTACGTGGGAGAGATCATTACCTCAGAGGAGGCAGAGCGGCGGGGCCAGATCTACGACCGTCAGGGCGCCACCTACCTCTTTGACCTGGACTACGTGGAGGACGTGTACACCGTGGATGCCGCCTACTATGGCAACATCTCCCACTTTGTCAACCACAGTTGTGACCCCAACCTGCAGGTGTACAACGTCTTCATAGACAACCTTGACGAGCGGCTGCCCCGCATCGCTTTCTTTGCCACAAGAACCATCCGGGCAGGCGAGGAGCTCACCTTTGATTACAACATGCAAGTGGACCCCGTGGACATGGAGAGCACCCGCATGGACTCCAACTTTGGCCTGGCTGGGCTCCCTGGCTCCCCTAAGAAGCGGGTCCGTATTGAATGCAAGTGTGGGACTGAGTCCTGCCGCAAATACCTCTTCTAG
ORF Protein Sequence MAENLKGCSVCCKSSWNQLQDLCRLAKLSCPALGISKRNLYDFEVEYLCDYKKIREQEYYLVKWRGYPDSESTWEPRQNLKCVRILKQFHKDLERELLRRHHRSKTPRHLDPSLANYLVQKAKQRRALRRWEQELNAKRSHLGRITVENEVDLDGPPRAFVYINEYRVGEGITLNQVAVGCECQDCLWAPTGGCCPGASLHKFAYNDQGQVRLRAGLPIYECNSRCRCGYDCPNRVVQKGIRYDLCIFRTDDGRGWGVRTLEKIRKNSFVMEYVGEIITSEEAERRGQIYDRQGATYLFDLDYVEDVYTVDAAYYGNISHFVNHSCDPNLQVYNVFIDNLDERLPRIAFFATRTIRAGEELTFDYNMQVDPVDMESTRMDSNFGLAGLPGSPKKRVRIECKCGTESCRKYLF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39519-Ab Anti-SUV39H1 monoclonal antibody
    Target Antigen GM-Tg-g-T39519-Ag SUV39H1 protein
    ORF Viral Vector pGMLP000110 Human SUV39H1 Lentivirus plasmid
    ORF Viral Vector vGMLP000110 Human SUV39H1 Lentivirus particle


    Target information

    Target ID GM-T39519
    Target Name SUV39H1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    6839
    Gene ID 100062108 (Equus caballus), 101083571 (Felis catus), 20937 (Mus musculus), 302553 (Rattus norvegicus)
    491868 (Canis lupus familiaris), 523047 (Bos taurus), 6839 (Homo sapiens), 711040 (Macaca mulatta)
    Gene Symbols & Synonyms SUV39H1,Suv39h1,mIS6,KMT1A,DXHXS7466e,H3-K9-HMTase 1,Suv39h1l1,RGD1565028,MG44,SUV39H
    Target Alternative Names SUV39H1,Histone-lysine N-methyltransferase SUV39H1,Histone H3-K9 methyltransferase 1 (H3-K9-HMTase 1), Lysine N-methyltransferase 1A, Position-effect variegation 3-9 homolog, Suppressor of variegation 3-9 homolog 1 (Su(var)3-9 homolog 1),MG44,KMT1A,SUV39H,H3-K9-HMTase 1
    Uniprot Accession O43463,O54864,Q2NL30
    Additional SwissProt Accessions: O54864,Q2NL30,O43463
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Metabolic pathways
    Gene Ensembl ENSECAG00000015438, ENSMUSG00000039231, ENSCAFG00845030815, ENSBTAG00000004706, ENSG00000101945, ENSMMUG00000019768
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.