Human MAPK8/JNK/JNK-46 ORF/cDNA clone-Lentivirus plasmid (NM_001323302.1)

Cat. No.: pGMLP-SPh-013
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPK8/JNK/JNK-46 Lentiviral expression plasmid for MAPK8 lentivirus packaging, MAPK8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to JNK/MAPK8/JNK1/MAPK8/JNK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $623.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP-SPh-013
Gene Name MAPK8
Accession Number NM_001323302.1
Gene ID 5599
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1155 bp
Gene Alias JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,PRKM8,SAPK1,SAPK1c
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAAATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTGCAGCAGTGA
ORF Protein Sequence MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDLWSVGCIMGEMVCHKILFPGRDYIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLAQVQQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T40097-Ab Anti-JNK1 monoclonal antibody
    Target Antigen GM-Tg-g-T40097-Ag JNK1/MAPK8 protein
    ORF Viral Vector pGMLP005225 Human MAPK8 Lentivirus plasmid
    ORF Viral Vector pGMAD000121 Human MAPK8 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-013 Human MAPK8 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-056 Human MAPK8 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-153 Human MAPK8 Adenovirus plasmid
    ORF Viral Vector pGMAP-SPh-196 Human MAPK8 Adenovirus plasmid
    ORF Viral Vector pGMPC000125 Human MAPK8 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005225 Human MAPK8 Lentivirus particle
    ORF Viral Vector vGMAD000121 Human MAPK8 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-013 Human MAPK8 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-056 Human MAPK8 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-153 Human MAPK8 Adenovirus particle
    ORF Viral Vector vGMAP-SPh-196 Human MAPK8 Adenovirus particle


    Target information

    Target ID GM-T40097
    Target Name JNK/MAPK8/JNK1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    5599
    Gene ID 100051798 (Equus caballus), 101091310 (Felis catus), 116554 (Rattus norvegicus), 26419 (Mus musculus)
    477746 (Canis lupus familiaris), 539941 (Bos taurus), 5599 (Homo sapiens), 711115 (Macaca mulatta)
    Gene Symbols & Synonyms MAPK8,Mapk8,JNK,JNK1,Prkm8,SAPK1,PRKM8,JNK-46,JNK1A2,SAPK1c,JNK21B1/2
    Target Alternative Names JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,MAP kinase 8,MAPK 8,MAPK8,Mapk8,Mitogen-activated protein kinase 8,PRKM8,Prkm8,SAPK1,SAPK1c,Stress-activated protein kinase 1c (SAPK1c),Stress-activated protein kinase JNK1,c-Jun N-terminal kinase 1
    Uniprot Accession P45983,P49185,Q91Y86
    Additional SwissProt Accessions: P49185,Q91Y86,P45983
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, cAMP signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Protein processing in endoplasmic reticulum, Apoptosis, Apoptosis - multiple species, Wnt signaling pathway, Osteoclast differentiation, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, C-type lectin receptor signaling pathway, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Neurotrophin signaling pathway, Inflammatory mediator regulation of TRP channels, GnRH signaling pathway, Prolactin signaling pathway, Adipocytokine signaling pathway, Relaxin signaling pathway, Type II diabetes mellitus, Insulin resistance, AGE-RAGE signaling pathway in diabetic complications, Growth hormone synthesis, secretion and action, Alcoholic liver disease, Alzheimer disease, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pertussis, Yersinia infection, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis B, Measles, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Choline metabolism in cancer, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSECAG00000008480, ENSMUSG00000021936, ENSCAFG00845019380, ENSBTAG00000007876, ENSG00000107643, ENSMMUG00000004060
    Target Classification Kinase, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.