Human IL26/AK155/IL-26 ORF/cDNA clone-Lentivirus plasmid (NM_018402)

Cat. No.: pGMLP-IL-033
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL26/AK155/IL-26 Lentiviral expression plasmid for IL26 lentivirus packaging, IL26 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL26/AK155 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $429
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP-IL-033
Gene Name IL26
Accession Number NM_018402
Gene ID 55801
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 516 bp
Gene Alias AK155,IL-26
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGTGAATTTCATTTTGAGGTGTGGGTTGCTGTTAGTCACTCTGTCTCTTGCCATTGCCAAGCACAAGCAATCTTCCTTCACCAAAAGTTGTTACCCAAGGGGAACATTGTCCCAAGCTGTTGACGCTCTCTATATCAAAGCAGCATGGCTCAAAGCAACGATTCCAGAAGACCGCATAAAAAATATACGATTATTAAAAAAGAAAACAAAAAAGCAGTTTATGAAAAACTGTCAATTTCAAGAACAGCTTCTGTCCTTCTTCATGGAAGACGTTTTTGGTCAACTGCAATTGCAAGGCTGCAAGAAAATACGCTTTGTGGAGGACTTTCATAGCCTTAGGCAGAAATTGAGCCACTGTATTTCCTGTGCTTCATCAGCTAGAGAGATGAAATCCATTACCAGGATGAAAAGAATATTTTATAGGATTGGAAACAAAGGAATCTACAAAGCCATCAGTGAACTGGATATTCTTCTTTCCTGGATTAAAAAATTATTGGAAAGCAGTCAGTAA
ORF Protein Sequence MLVNFILRCGLLLVTLSLAIAKHKQSSFTKSCYPRGTLSQAVDALYIKAAWLKATIPEDRIKNIRLLKKKTKKQFMKNCQFQEQLLSFFMEDVFGQLQLQGCKKIRFVEDFHSLRQKLSHCISCASSAREMKSITRMKRIFYRIGNKGIYKAISELDILLSWIKKLLESSQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1025-Ab Anti-IL26/ AK155/ IL-26 functional antibody
    Target Antigen GM-Tg-g-SE1025-Ag IL26 protein
    Cytokine cks-Tg-g-GM-SE1025 interleukin 26 (IL26) protein & antibody
    ORF Viral Vector pGMLP-IL-033 Human IL26 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-116 Human IL26 Adenovirus plasmid
    ORF Viral Vector vGMLP-IL-033 Human IL26 Lentivirus particle
    ORF Viral Vector vGMAP-IL-116 Human IL26 Adenovirus particle


    Target information

    Target ID GM-SE1025
    Target Name IL26
    Gene Group Identifier
    (Target Gene ID in Homo species)
    55801
    Gene ID 100629204 (Equus caballus), 101094939 (Felis catus), 55801 (Homo sapiens), 608923 (Canis lupus familiaris)
    718027 (Macaca mulatta), 782075 (Bos taurus)
    Gene Symbols & Synonyms IL26,AK155,IL-26
    Target Alternative Names IL26,Interleukin-26,IL-26,Protein AK155,AK155,IL-26
    Uniprot Accession Q9NPH9
    Additional SwissProt Accessions: Q9NPH9
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction
    Gene Ensembl ENSG00000111536, ENSCAFG00845013704, ENSMMUG00000004367, ENSBTAG00000052655
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.