Human IL18/IGIF/IL-18 ORF/cDNA clone-Lentivirus plasmid (NM_001562)

Cat. No.: pGMLP-IL-025
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL18/IGIF/IL-18 Lentiviral expression plasmid for IL18 lentivirus packaging, IL18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL-18/IL18/IL18/IGIF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $445.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP-IL-025
Gene Name IL18
Accession Number NM_001562
Gene ID 3606
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 582 bp
Gene Alias IGIF,IL-18,IL-1g,IL1F4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTTTACTTTATAGCTGAAGATGATGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAATTTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGACTGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATGGCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTTAAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTCCCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTTCTAGCTTGTGAAAAAGAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTGGGGGATAGATCTATAATGTTCACTGTTCAAAACGAAGACTAG
ORF Protein Sequence MAAEPVEDNCINFVAMKFIDNTLYFIAEDDENLESDYFGKLESKLSVIRNLNDQVLFIDQGNRPLFEDMTDSDCRDNAPRTIFIISMYKDSQPRGMAVTISVKCEKISTLSCENKIISFKEMNPPDNIKDTKSDIIFFQRSVPGHDNKMQFESSSYEGYFLACEKERDLFKLILKKEDELGDRSIMFTVQNED

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T06671-Ab Anti-IL18/ IGIF/ IL-18 functional antibody
    Target Antigen GM-Tg-g-T06671-Ag IL18 protein
    Cytokine cks-Tg-g-GM-T06671 interleukin 18 (IL18) protein & antibody
    ORF Viral Vector pGMLP002771 Human IL18 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-025 Human IL18 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-108 Human IL18 Adenovirus plasmid
    ORF Viral Vector vGMLP002771 Human IL18 Lentivirus particle
    ORF Viral Vector vGMLP-IL-025 Human IL18 Lentivirus particle
    ORF Viral Vector vGMAP-IL-108 Human IL18 Adenovirus particle


    Target information

    Target ID GM-T06671
    Target Name IL-18/IL18
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3606
    Gene ID 100034216 (Equus caballus), 16173 (Mus musculus), 281249 (Bos taurus), 29197 (Rattus norvegicus)
    3606 (Homo sapiens), 403796 (Canis lupus familiaris), 493688 (Felis catus), 574151 (Macaca mulatta)
    Gene Symbols & Synonyms IL18,Il18,IGIF,IL-18,Igif,Il-18,IL-1 gamma,IL-1g,IL1F4
    Target Alternative Names IL-18, IL18,Interleukin-18,IL-18,Iboctadekin, Interferon gamma-inducing factor (IFN-gamma-inducing factor), Interleukin-1 gamma (IL-1 gamma),IGIF,IL-18,IL-1g,IL1F4
    Uniprot Accession P70380,P97636,Q14116,Q95M33,Q9TU73,Q9XSQ7,Q9XSR0
    Additional SwissProt Accessions: Q9XSQ7,P70380,Q9TU73,P97636,Q14116,Q9XSR0,Q95M33
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer, Breast Cancer, Acute kidney failure, Overweight
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, NOD-like receptor signaling pathway, Pathogenic Escherichia coli infection, Legionellosis, Yersinia infection, African trypanosomiasis, Malaria, Tuberculosis, Influenza A, Inflammatory bowel disease, Rheumatoid arthritis, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000015261, ENSMUSG00000039217, ENSBTAG00000000277, ENSG00000150782, ENSCAFG00845001557, ENSMMUG00000064111
    Target Classification Cytokine Receptor


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.