Human CSN1S1 ORF/cDNA clone-Adenovirus plasmid (BC128227)

Cat. No.: pGMAP000479
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CSN1S1/ adenoviral expression plasmid for CSN1S1 adenovirus packaging, CSN1S1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to CSN1S1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000479
Gene Name CSN1S1
Accession Number BC128227
Gene ID 1446
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 558 bp
Gene Alias
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGCTTCTCATTCTCACCTGTCTTGTGGCTGTTGCTCTTGCCAGGCCTAAACTTCCTCTTAGATACCCAGAACGCCTTCAGAATCCATCAGAGAGCAGTGAGCCTATACCATTAGAATCAAGAGAGGAATACATGAATGGTATGAACAGGCAGAGAAACATTCTGAGAGAAAAACAGACTGATGAAATCAAGGATACTAGGAATGAGTCTACTCAGAACTGTGTTGTGGCAGAGCCTGAGAAGATGGAATCCAGCATCAGTTCATCGAGTGAGGAAATGTCTCTCAGTAAGTGTGCGGAACAGTTTTGTAGACTGAACGAATACAACCAACTTCAGCTGCAAGCTGCCCATGCCCAGGAGCAAATTCGCAGAATGAATGAAAACAGCCATGTCCAAGTGCCTTTCCAGCAGCTCAACCAACTTGCTGCCTACCCCTATGCTGTTTGGTACTATCCACAAATCATGCAGTATGTTCCTTTCCCACCGTTTTCCGACATCTCCAATCCCACTGCTCATGAAAATTATGAAAAAAATAACGTCATGCTACAGTGGTGA
ORF Protein Sequence MRLLILTCLVAVALARPKLPLRYPERLQNPSESSEPIPLESREEYMNGMNRQRNILREKQTDEIKDTRNESTQNCVVAEPEKMESSISSSSEEMSLSKCAEQFCRLNEYNQLQLQAAHAQEQIRRMNENSHVQVPFQQLNQLAAYPYAVWYYPQIMQYVPFPPFSDISNPTAHENYEKNNVMLQW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0829-Ab Anti-CASA1/ CSN1S1/ CASA functional antibody
    Target Antigen GM-Tg-g-SE0829-Ag CSN1S1 protein
    ORF Viral Vector pGMLP000549 Human CSN1S1 Lentivirus plasmid
    ORF Viral Vector pGMAP000479 Human CSN1S1 Adenovirus plasmid
    ORF Viral Vector vGMLP000549 Human CSN1S1 Lentivirus particle
    ORF Viral Vector vGMAP000479 Human CSN1S1 Adenovirus particle


    Target information

    Target ID GM-SE0829
    Target Name CSN1S1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    1446
    Gene ID 100033982 (Equus caballus), 102902663 (Felis catus), 12990 (Mus musculus), 1446 (Homo sapiens)
    24284 (Rattus norvegicus), 282208 (Bos taurus)
    Gene Symbols & Synonyms CSN1S1,Csn1s1,CSNS1,Csna,CASA,CSN1,Casa,Csn1
    Target Alternative Names Alpha-S1-casein,CASA,CSN1,CSN1S1,CSNS1,Casa,Csn1,Csn1s1,Csna
    Uniprot Accession P02661,P02662,P19228,P47710
    Additional SwissProt Accessions: P19228,P47710,P02661,P02662
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000014318, ENSMUSG00000070702, ENSG00000126545, ENSBTAG00000007695
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.