Human IL13/ALRH/BHR1 ORF/cDNA clone-Adenovirus plasmid (BC096139)

Cat. No.: pGMAP000460
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL13/ALRH/BHR1 adenoviral expression plasmid for IL13 adenovirus packaging, IL13 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IL-13/IL13/IL13/ALRH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000460
Gene Name IL13
Accession Number BC096139
Gene ID 3596
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 441 bp
Gene Alias ALRH,BHR1,IL-13,P600
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCATCCGCTCCTCAATCCTCTCCTGTTGGCACTGGGCCTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGAACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGACCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCTTGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATTTAAAGAAACTTTTTCGCGAGGGACAGTTCAACTGA
ORF Protein Sequence MHPLLNPLLLALGLMALLLTTVIALTCLGGFASPGPVPPSTALRELIEELVNITQNQKAPLCNGSMVWSINLTAGMYCAALESLINVSGCSAIEKTQRMLSGFCPHKVSAGQFSSLHVRDTKIEVAQFVKDLLLHLKKLFREGQFN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-098 Pre-Made Cendakimab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-136 Pre-Made Dectrekumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-004 Pre-Made Abrezekimab biosimilar, Fab, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-592 Pre-Made Tralokinumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-199 Pre-Made Etokimab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-492 Pre-Made Romilkimab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL13;IL4 Antibody: Anti-IL-13/P600;BCGF-1/BCGF1/BSF-1/BSF1/IL-4 therapeutic antibody
    Biosimilar GMP-Bios-ab-027 Pre-Made Anrukinzumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-299 Pre-Made Lebrikizumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Target Antibody GM-Tg-g-T29143-Ab Anti-IL13/ IL-13/ P600 functional antibody
    Target Antigen GM-Tg-g-T29143-Ag IL13 protein
    ORF Viral Vector pGMLP000547 Human IL13 Lentivirus plasmid
    ORF Viral Vector pGMAP000460 Human IL13 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-017 Human IL13 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-100 Human IL13 Adenovirus plasmid
    ORF Viral Vector vGMLP000547 Human IL13 Lentivirus particle
    ORF Viral Vector vGMAP000460 Human IL13 Adenovirus particle
    ORF Viral Vector vGMLP-IL-017 Human IL13 Lentivirus particle
    ORF Viral Vector vGMAP-IL-100 Human IL13 Adenovirus particle


    Target information

    Target ID GM-T29143
    Target Name IL-13/IL13
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3596
    Gene ID 100034113 (Equus caballus), 101084678 (Felis catus), 116553 (Rattus norvegicus), 16163 (Mus musculus)
    281247 (Bos taurus), 3596 (Homo sapiens), 442990 (Canis lupus familiaris), 574325 (Macaca mulatta)
    Gene Symbols & Synonyms IL13,Il13,IL-13,Il-13,P600
    Target Alternative Names IL-13,IL13,Il-13,Il13,Interleukin-13,P600
    Uniprot Accession P20109,P35225,P42203,Q864V6,Q9N0W9,Q9XSV9
    Additional SwissProt Accessions: P42203,P20109,Q9XSV9,P35225,Q9N0W9,Q864V6
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease cancer, Breast Cancer, asthma, Malignant neoplasm of bladder
    Disease from KEGG Cytokine-cytokine receptor interaction, JAK-STAT signaling pathway, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Fc epsilon RI signaling pathway, Pathways in cancer, Asthma, Inflammatory bowel disease
    Gene Ensembl ENSECAG00000009732, ENSMUSG00000020383, ENSBTAG00000015953, ENSG00000169194, ENSCAFG00845010953, ENSMMUG00000003131
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.