Human GAPDH/G3PD ORF/cDNA clone-Adenovirus plasmid (BC001601)

Cat. No.: pGMAP000245
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GAPDH/G3PD adenoviral expression plasmid for GAPDH adenovirus packaging, GAPDH adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GAPDH/G3PD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000245
Gene Name GAPDH
Accession Number BC001601
Gene ID 2597
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1008 bp
Gene Alias G3PD
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAA
ORF Protein Sequence MGKVKVGVNGFGRIGRLVTRAAFNSGKVDIVAINDPFIDLNYMVYMFQYDSTHGKFHGTVKAENGKLVINGNPITIFQERDPSKIKWGDAGAEYVVESTGVFTTMEKAGAHLQGGAKRVIISAPSADAPMFVMGVNHEKYDNSLKIISNASCTTNCLAPLAKVIHDNFGIVEGLMTTVHAITATQKTVDGPSGKLWRDGRGALQNIIPASTGAAKAVGKVIPELNGKLTGMAFRVPTANVSVVDLTCRLEKPAKYDDIKKVVKQASEGPLKGILGYTEHQVVSSDFNSDTHSSTFDAGAGIALNDHFVKLISWYDNEFGYSNRVVDLMAHMASKE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39321-Ab Anti-G3P/ GAPDH/ G3PD monoclonal antibody
    Target Antigen GM-Tg-g-T39321-Ag GAPDH VLP (virus-like particle)
    ORF Viral Vector pGMLP001944 Human GAPDH Lentivirus plasmid
    ORF Viral Vector pGMAP000245 Human GAPDH Adenovirus plasmid
    ORF Viral Vector vGMLP001944 Human GAPDH Lentivirus particle
    ORF Viral Vector vGMAP000245 Human GAPDH Adenovirus particle


    Target information

    Target ID GM-T39321
    Target Name GAPDH
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2597
    Gene ID 100033897 (Equus caballus), 14433 (Mus musculus), 24383 (Rattus norvegicus), 2597 (Homo sapiens)
    281181 (Bos taurus), 403755 (Canis lupus familiaris), 493876 (Felis catus), 574353 (Macaca mulatta)
    Gene Symbols & Synonyms GAPDH,Gapdh,G3PDH,Gapd,BARS-38,G3PD,GAPD,HEL-S-162eP
    Target Alternative Names BARS-38,G3PD,G3PDH,GAPD,GAPDH,Gapd,Gapdh,Glyceraldehyde-3-phosphate dehydrogenase,HEL-S-162eP,Peptidyl-cysteine S-nitrosylase GAPDH
    Uniprot Accession P04406,P04797,P10096,P16858,Q28259,Q9N2D5
    Additional SwissProt Accessions: P16858,P04797,P04406,P10096,Q28259,Q9N2D5
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Metabolic pathways, HIF-1 signaling pathway, Alzheimer disease, Pathogenic Escherichia coli infection
    Gene Ensembl ENSECAG00000022051, ENSMUSG00000057666, ENSG00000111640, ENSBTAG00000014731, ENSCAFG00845028918, ENSMMUG00000018679
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.