Human AQP1/AQP-CHIP/CHIP28 ORF/cDNA clone-Adenovirus plasmid (BC022486)

Cat. No.: pGMAP000072
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP1/AQP-CHIP/CHIP28 adenoviral expression plasmid for AQP1 adenovirus packaging, AQP1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AQP1/AQP-CHIP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000072
Gene Name AQP1
Accession Number BC022486
Gene ID 358
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 810 bp
Gene Alias AQP-CHIP,CHIP28,MGC26324
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGACGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG
ORF Protein Sequence MASEFKKKLFWRAVVAEFLATTLFVFISIGSALGFKYPVGNNQTTVQDNVKVSLAFGLSIATLAQSVGHISGAHLNPAVTLGLLLSCQISIFRALMYIIAQCVGAIVATAILSGITSSLTGNSLGRNDLADGVNSGQGLGIEIIGTLQLVLCVLATTDRRRRDLGGSAPLAIGLSVALGHLLAIDYTGCGINPARSFGSAVITHNFSNHWIFWVGPFIGGALAVLIYDFILAPRSSDLTDRVKVWTSGQVEEYDLDADDINSRVEMKPK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44057-Ab Anti-AQP1/ AQP-CHIP/ CHIP28 monoclonal antibody
    Target Antigen GM-Tg-g-T44057-Ag AQP1 VLP (virus-like particle)
    ORF Viral Vector pGMLV001070 Human AQP1 Lentivirus plasmid
    ORF Viral Vector pGMAP000072 Human AQP1 Adenovirus plasmid
    ORF Viral Vector vGMLV001070 Human AQP1 Lentivirus particle
    ORF Viral Vector vGMAP000072 Human AQP1 Adenovirus particle


    Target information

    Target ID GM-T44057
    Target Name AQP1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		358
    Gene ID 100069916 (Equus caballus), 101087725 (Felis catus), 106997467 (Macaca mulatta), 11826 (Mus musculus)
    25240 (Rattus norvegicus), 282653 (Bos taurus), 358 (Homo sapiens), 403732 (Canis lupus familiaris)
    Gene Symbols & Synonyms AQP1,Aqp1,CHIP28,AQP-1,CHIP29,CO,AQP-CHIP
    Target Alternative Names AQP-1,AQP-CHIP,AQP1,Aqp1,Aquaporin-1,Aquaporin-CHIP,CHIP28,CHIP29,CO,Channel-like integral membrane protein of 28 kDa,Urine water channel
    Uniprot Accession P29972,P29975,P47865,Q02013,Q9N2J4
    Additional SwissProt Accessions: Q02013,P29975,P47865,P29972,Q9N2J4
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease cancer, Renal cell carcinoma, Renal carcinoma
    Disease from KEGG Renin secretion, Bile secretion
    Gene Ensembl ENSECAG00000008979, ENSMUSG00000004655, ENSG00000240583, ENSCAFG00845020628
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.