Human INS ORF/cDNA clone-Adenovirus plasmid (BC005255)

Cat. No.: pGMAP000054
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human INS/ adenoviral expression plasmid for INS adenovirus packaging, INS adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to INS products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000054
Gene Name INS
Accession Number BC005255
Gene ID 3630
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 333 bp
Gene Alias
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
ORF Protein Sequence MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T82841-Ab Anti-INS/ IDDM/ IDDM1 functional antibody
    Target Antigen GM-Tg-g-T82841-Ag INS protein
    ORF Viral Vector pGMAP000054 Human INS Adenovirus plasmid
    ORF Viral Vector vGMAP000054 Human INS Adenovirus particle


    Target information

    Target ID GM-T82841
    Target Name INS
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3630
    Gene ID 111776000 (Equus caballus), 16334 (Mus musculus), 24506 (Rattus norvegicus), 280829 (Bos taurus)
    3630 (Homo sapiens), 483665 (Canis lupus familiaris), 493804 (Felis catus), 704534 (Macaca mulatta)
    Gene Symbols & Synonyms INS,Ins2,Mody,Ins-2,InsII,Mody4,CP-II,IDDM,ILPR,IRDN,IDDM1,IDDM2,PNDM4,MODY10
    Target Alternative Names CP-II,IDDM,IDDM1,IDDM2,ILPR,INS,IRDN,Ins-2,Ins2,InsII,Insulin,MODY10,Mody,Mody4,PNDM4
    Uniprot Accession P01308,P01310,P01317,P01321,P01323,P01326,P06306
    Additional SwissProt Accessions: P01310,P01326,P01323,P01317,P01308,P01321,P06306
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease
    Disease from KEGG MAPK signaling pathway, Ras signaling pathway, Rap1 signaling pathway, cGMP-PKG signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, Phospholipase D signaling pathway, PI3K-Akt signaling pathway, Longevity regulating pathway, Longevity regulating pathway - multiple species, Regulation of actin cytoskeleton, Insulin secretion, Ovarian steroidogenesis, Prolactin signaling pathway, Regulation of lipolysis in adipocytes, Type II diabetes mellitus, Insulin resistance, Type I diabetes mellitus, Aldosterone-regulated sodium reabsorption, Alzheimer disease, Prostate cancer
    Gene Ensembl ENSMUSG00000000215, ENSBTAG00000013003, ENSG00000254647, ENSCAFG00845011141, ENSMMUG00000031267
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.