Human IL33/C9orf26/DVS27 ORF/cDNA clone-Adenovirus plasmid (NM_033439)

Cat. No.: pGMAP-IL-120
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL33/C9orf26/DVS27 adenoviral expression plasmid for IL33 adenovirus packaging, IL33 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to IL-33/IL33/IL33/C9orf26 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-IL-120
Gene Name IL33
Accession Number NM_033439
Gene ID 90865
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 813 bp
Gene Alias C9orf26,DVS27,IL1F11,NF-HEV,NFEHEV
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAAGCCTTGTGTTTCAAGCTGGGAAAATCCCAACAGAAGGCCAAAGAAGTTTGCCCCATGTACTTTATGAAGCTCCGCTCTGGCCTTATGATAAAAAAGGAGGCCTGTTACTTTAGGAGAGAAACCACCAAAAGGCCTTCACTGAAAACAGGTAGAAAGCACAAAAGACATCTGGTACTCGCTGCCTGTCAACAGCAGTCTACTGTGGAGTGCTTTGCCTTTGGTATATCAGGGGTCCAGAAATATACTAGAGCACTTCATGATTCAAGTATCACAGGAATTTCACCTATTACAGAGTATCTTGCTTCTCTAAGCACATACAATGATCAATCCATTACTTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAG
ORF Protein Sequence MKPKMKYSTNKISTAKWKNTASKALCFKLGKSQQKAKEVCPMYFMKLRSGLMIKKEACYFRRETTKRPSLKTGRKHKRHLVLAACQQQSTVECFAFGISGVQKYTRALHDSSITGISPITEYLASLSTYNDQSITFALEDESYEIYVEDLKKDEKKDKVLLSYYESQHPSNESGDGVDGKMLMVTLSPTKDFWLHANNKEHSVELHKCEKPLPDQAFFVLHNMHSNCVSFECKTDPGVFIGVKDNHLALIKVDSSENLCTENILFKLSET

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-591 Pre-Made Tozorakimab biosimilar, Whole mAb, Anti-IL33 Antibody: Anti-C9orf26/DVS27/IL1F11/NF-HEV/NFEHEV therapeutic antibody
    Biosimilar GMP-Bios-ab-588 Pre-Made Torudokimab biosimilar, Whole mAb, Anti-IL33 Antibody: Anti-C9orf26/DVS27/IL1F11/NF-HEV/NFEHEV therapeutic antibody
    Biosimilar GMP-Bios-ab-283 Pre-Made Itepekimab biosimilar, Whole mAb, Anti-IL33 Antibody: Anti-C9orf26/DVS27/IL1F11/NF-HEV/NFEHEV therapeutic antibody
    Target Antibody GM-Tg-g-T23797-Ab Anti-IL33/ C9orf26/ DVS27 functional antibody
    Target Antigen GM-Tg-g-T23797-Ag IL33 protein
    Cytokine cks-Tg-g-GM-T23797 Interleukin 33 (IL33) protein & antibody
    ORF Viral Vector pGMLV000045 Human IL33 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-037 Human IL33 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-120 Human IL33 Adenovirus plasmid
    ORF Viral Vector vGMLV000045 Human IL33 Lentivirus particle
    ORF Viral Vector vGMLP-IL-037 Human IL33 Lentivirus particle
    ORF Viral Vector vGMAP-IL-120 Human IL33 Adenovirus particle


    Target information

    Target ID GM-T23797
    Target Name IL-33/IL33
    Gene Group Identifier
    (Target Gene ID in Homo species)
    90865
    Gene ID 100059908 (Equus caballus), 101093403 (Felis catus), 361749 (Rattus norvegicus), 403810 (Canis lupus familiaris)
    507054 (Bos taurus), 717301 (Macaca mulatta), 77125 (Mus musculus), 90865 (Homo sapiens)
    Gene Symbols & Synonyms IL33,Il33,RGD1311155,DVS27,Il-33,Il1f11,NF-HEV,9230117N10Rik,IL1F11,NFEHEV,C9orf26
    Target Alternative Names 9230117N10Rik,C9orf26,DVS27,IL-33,IL1F11,IL33,Il-33,Il1f11,Il33,Interleukin-1 family member 11 (IL-1F11),Interleukin-33,NF-HEV,NFEHEV,Nuclear factor from high endothelial venules (NF-HEV),RGD1311155
    Uniprot Accession O95760,O97863,Q66H70,Q8BVZ5
    Additional SwissProt Accessions: Q66H70,O97863,Q8BVZ5,O95760
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, Influenza A
    Gene Ensembl ENSECAG00000010475, ENSCAFG00845024013, ENSBTAG00000018347, ENSMMUG00000021344, ENSMUSG00000024810, ENSG00000137033
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.