Human IL27/IL-27/IL-27A ORF/cDNA clone-Adenovirus plasmid (NM_145659)

Cat. No.: pGMAP-IL-117
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL27/IL-27/IL-27A adenoviral expression plasmid for IL27 adenovirus packaging, IL27 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IL-27/IL-27A/IL27/IL27/IL-27 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-IL-117
Gene Name IL27
Accession Number NM_145659
Gene ID 246778
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 732 bp
Gene Alias IL-27,IL-27A,IL27A,IL27p28,IL30,p28
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGGCCAGACGGCAGGCGACCTTGGCTGGCGGCTCAGCCTGTTGCTGCTTCCCTTGCTCCTGGTTCAAGCTGGTGTCTGGGGATTCCCAAGGCCCCCAGGGAGGCCCCAGCTGAGCCTGCAGGAGCTGCGGAGGGAGTTCACAGTCAGCCTGCATCTCGCCAGGAAGCTGCTCTCCGAGGTTCGGGGCCAGGCCCACCGCTTTGCGGAATCTCACCTGCCAGGAGTGAACCTGTACCTCCTGCCCCTGGGAGAGCAGCTCCCTGATGTTTCCCTGACCTTCCAGGCCTGGCGCCGCCTCTCTGACCCGGAGCGTCTCTGCTTCATCTCCACCACGCTTCAGCCCTTCCATGCCCTGCTGGGAGGGCTGGGGACCCAGGGCCGCTGGACCAACATGGAGAGGATGCAGCTGTGGGCCATGAGGCTGGACCTCCGCGATCTGCAGCGGCACCTCCGCTTCCAGGTGCTGGCTGCAGGATTCAACCTCCCGGAGGAGGAGGAGGAGGAAGAGGAGGAGGAGGAGGAGGAGAGGAAGGGGCTGCTCCCAGGGGCACTGGGCAGCGCCTTACAGGGCCCGGCCCAGGTGTCCTGGCCCCAGCTCCTCTCCACCTACCGCCTGCTGCACTCCTTGGAGCTCGTCTTATCTCGGGCCGTGCGGGAGTTGCTGCTGCTGTCCAAGGCTGGGCACTCAGTCTGGCCCTTGGGGTTCCCAACATTGAGCCCCCAGCCCTGA
ORF Protein Sequence MGQTAGDLGWRLSLLLLPLLLVQAGVWGFPRPPGRPQLSLQELRREFTVSLHLARKLLSEVRGQAHRFAESHLPGVNLYLLPLGEQLPDVSLTFQAWRRLSDPERLCFISTTLQPFHALLGGLGTQGRWTNMERMQLWAMRLDLRDLQRHLRFQVLAAGFNLPEEEEEEEEEEEEERKGLLPGALGSALQGPAQVSWPQLLSTYRLLHSLELVLSRAVRELLLLSKAGHSVWPLGFPTLSPQP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1026-Ab Anti-IL27A/ IL27/ IL-27 functional antibody
    Target Antigen GM-Tg-g-SE1026-Ag IL27 protein
    ORF Viral Vector pGMLP002772 Human IL27 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-034 Human IL27 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-117 Human IL27 Adenovirus plasmid
    ORF Viral Vector vGMLP002772 Human IL27 Lentivirus particle
    ORF Viral Vector vGMLP-IL-034 Human IL27 Lentivirus particle
    ORF Viral Vector vGMAP-IL-117 Human IL27 Adenovirus particle


    Target information

    Target ID GM-SE1026
    Target Name IL-27/IL-27A/IL27
    Gene Group Identifier
    （Target Gene ID in Homo species)         		246778
    Gene ID 100066317 (Equus caballus), 101093822 (Felis catus), 246778 (Homo sapiens), 246779 (Mus musculus)
    365368 (Rattus norvegicus), 607880 (Canis lupus familiaris), 614927 (Bos taurus), 708678 (Macaca mulatta)
    Gene Symbols & Synonyms IL27,Il27,p28,IL30,IL-27,IL27A,IL-27A,IL27p28,Il30,IL27-A,IL-27-A,IL-27p28,RGD1561420,IL-27alpha
    Target Alternative Names IL-27,IL-27 subunit alpha,IL-27-A,IL-27A,IL-27alpha,IL-27p28,IL27,IL27-A,IL27A,IL27p28,IL30,Il27,Il30,Interleukin-27 subunit alpha,Interleukin-30,RGD1561420,p28
    Uniprot Accession Q8K3I6,Q8NEV9
    Additional SwissProt Accessions: Q8NEV9,Q8K3I6
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, Th17 cell differentiation
    Gene Ensembl ENSECAG00000014957, ENSG00000197272, ENSMUSG00000044701, ENSCAFG00845002305, ENSBTAG00000018015, ENSMMUG00000045351
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.