Human IL5/EDF/IL-5 ORF/cDNA clone-Adenovirus plasmid (NM_000879)

Cat. No.: pGMAP-IL-091
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL5/EDF/IL-5 adenoviral expression plasmid for IL5 adenovirus packaging, IL5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to IL-5/IL5/IL5/EDF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-IL-091
Gene Name IL5
Accession Number NM_000879
Gene ID 3567
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 405 bp
Gene Alias EDF,IL-5,TRF
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGGATGCTTCTGCATTTGAGTTTGCTAGCTCTTGGAGCTGCCTACGTGTATGCCATCCCCACAGAAATTCCCACAAGTGCATTGGTGAAAGAGACCTTGGCACTGCTTTCTACTCATCGAACTCTGCTGATAGCCAATGAGACTCTGAGGATTCCTGTTCCTGTACATAAAAATCACCAACTGTGCACTGAAGAAATCTTTCAGGGAATAGGCACACTGGAGAGTCAAACTGTGCAAGGGGGTACTGTGGAAAGACTATTCAAAAACTTGTCCTTAATAAAGAAATACATTGACGGCCAAAAAAAAAAGTGTGGAGAAGAAAGACGGAGAGTAAACCAATTCCTAGACTACCTGCAAGAGTTTCTTGGTGTAATGAACACCGAGTGGATAATAGAAAGTTGA
ORF Protein Sequence MRMLLHLSLLALGAAYVYAIPTEIPTSALVKETLALLSTHRTLLIANETLRIPVPVHKNHQLCTEEIFQGIGTLESQTVQGGTVERLFKNLSLIKKYIDGQKKKCGEERRRVNQFLDYLQEFLGVMNTEWIIES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-479 Pre-Made Reslizumab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody
    Biosimilar GMP-Bios-ab-142 Pre-Made Depemokimab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody
    Biosimilar GMP-Bios-ab-341 Pre-Made Mepolizumab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody
    Target Antibody GM-Tg-g-T78585-Ab Anti-IL5/ EDF/ IL-5 functional antibody
    Target Antigen GM-Tg-g-T78585-Ag IL5 protein
    ORF Viral Vector pGMLP004769 Human IL5 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-008 Human IL5 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-091 Human IL5 Adenovirus plasmid
    ORF Viral Vector vGMLP004769 Human IL5 Lentivirus particle
    ORF Viral Vector vGMLP-IL-008 Human IL5 Lentivirus particle
    ORF Viral Vector vGMAP-IL-091 Human IL5 Adenovirus particle


    Target information

    Target ID GM-T78585
    Target Name IL-5/IL5
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3567
    Gene ID 100034199 (Equus caballus), 16191 (Mus musculus), 24497 (Rattus norvegicus), 280825 (Bos taurus)
    3567 (Homo sapiens), 403790 (Canis lupus familiaris), 493803 (Felis catus), 710622 (Macaca mulatta)
    Gene Symbols & Synonyms IL5,Il5,IL-5,Il-5,TRF,EDF
    Target Alternative Names B-cell differentiation factor I,EDF,Eosinophil differentiation factor,IL-5,IL5,Il-5,Il5,Interleukin-5,T-cell replacing factor (TRF),TRF
    Uniprot Accession O02699,O77515,P04401,P05113,P48093,P52173,Q08125,Q95J76
    Additional SwissProt Accessions: O02699,P04401,Q08125,P52173,P05113,Q95J76,O77515,P48093
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Hodgkin's disease, Overactive bladder
    Disease from KEGG Cytokine-cytokine receptor interaction, JAK-STAT signaling pathway, Hematopoietic cell lineage, IL-17 signaling pathway, Th1 and Th2 cell differentiation, T cell receptor signaling pathway, Fc epsilon RI signaling pathway, Intestinal immune network for IgA production, Pathways in cancer, Asthma, Autoimmune thyroid disease, Inflammatory bowel disease, Allograft rejection
    Gene Ensembl ENSECAG00000016648, ENSMUSG00000036117, ENSBTAG00000031235, ENSG00000113525, ENSCAFG00845010566, ENSMMUG00000051989
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.