Human IL1A/IL-1A/IL1 ORF/cDNA clone-Adenovirus plasmid (NM_000575)

Cat. No.: pGMAP-IL-084
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL1A/IL-1A/IL1 adenoviral expression plasmid for IL1A adenovirus packaging, IL1A adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IL-1 alpha/IL1A/IL1A/IL-1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-IL-084
Gene Name IL1A
Accession Number NM_000575
Gene ID 3552
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 816 bp
Gene Alias IL-1A,IL1,IL1-ALPHA,IL1F1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCAAAGTTCCAGACATGTTTGAAGACCTGAAGAACTGTTACAGTGAAAATGAAGAAGACAGTTCCTCCATTGATCATCTGTCTCTGAATCAGAAATCCTTCTATCATGTAAGCTATGGCCCACTCCATGAAGGCTGCATGGATCAATCTGTGTCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAGCTTACCTTCAAGGAGAGCATGGTGGTAGTAGCAACCAACGGGAAGGTTCTGAAGAAGAGACGGTTGAGTTTAAGCCAATCCATCACTGATGATGACCTGGAGGCCATCGCCAATGACTCAGAGGAAGAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGCAATGTGAAATACAACTTTATGAGGATCATCAAATACGAATTCATCCTGAATGACGCCCTCAATCAAAGTATAATTCGAGCCAATGATCAGTACCTCACGGCTGCTGCATTACATAATCTGGATGAAGCAGTGAAATTTGACATGGGTGCTTATAAGTCATCAAAGGATGATGCTAAAATTACCGTGATTCTAAGAATCTCAAAAACTCAATTGTATGTGACTGCCCAAGATGAAGACCAACCAGTGCTGCTGAAGGAGATGCCTGAGATACCCAAAACCATCACAGGTAGTGAGACCAACCTCCTCTTCTTCTGGGAAACTCACGGCACTAAGAACTATTTCACATCAGTTGCCCATCCAAACTTGTTTATTGCCACAAAGCAAGACTACTGGGTGTGCTTGGCAGGGGGGCCACCCTCTATCACTGACTTTCAGATACTGGAAAACCAGGCGTAG
ORF Protein Sequence MAKVPDMFEDLKNCYSENEEDSSSIDHLSLNQKSFYHVSYGPLHEGCMDQSVSLSISETSKTSKLTFKESMVVVATNGKVLKKRRLSLSQSITDDDLEAIANDSEEEIIKPRSAPFSFLSNVKYNFMRIIKYEFILNDALNQSIIRANDQYLTAAALHNLDEAVKFDMGAYKSSKDDAKITVILRISKTQLYVTAQDEDQPVLLKEMPEIPKTITGSETNLLFFWETHGTKNYFTSVAHPNLFIATKQDYWVCLAGGPPSITDFQILENQA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-063 Pre-Made Bermekimab biosimilar, Whole mAb, Anti-IL1A Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha therapeutic antibody
    Biosimilar GMP-Bios-ab-331 Pre-Made Lutikizumab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL1A;IL1B Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha;IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody
    Target Antibody GM-Tg-g-T16340-Ab Anti-IL1A/ IL-1A/ IL1 monoclonal antibody
    Target Antigen GM-Tg-g-T16340-Ag IL1A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T16340 interleukin 1, alpha (IL1A) protein & antibody
    ORF Viral Vector pGMAP000157 Human IL1A Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-001 Human IL1A Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-084 Human IL1A Adenovirus plasmid
    ORF Viral Vector vGMAP000157 Human IL1A Adenovirus particle
    ORF Viral Vector vGMLP-IL-001 Human IL1A Lentivirus particle
    ORF Viral Vector vGMAP-IL-084 Human IL1A Adenovirus particle


    Target information

    Target ID GM-T16340
    Target Name IL-1 alpha/IL1A
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3552
    Gene ID 100064969 (Equus caballus), 16175 (Mus musculus), 24493 (Rattus norvegicus), 281250 (Bos taurus)
    3552 (Homo sapiens), 403782 (Canis lupus familiaris), 493944 (Felis catus), 700193 (Macaca mulatta)
    Gene Symbols & Synonyms IL1A,Il1a,Il-1a,IL-1F1,IL-1 alpha,IL1,IL-1A,IL1F1,IL1-ALPHA,L1A
    Target Alternative Names Hematopoietin-1,IL-1 alpha,IL-1A,IL-1F1,IL1,IL1-ALPHA,IL1A,IL1F1,Il-1a,Il1a,Interleukin-1 alpha,L1A
    Uniprot Accession O46612,O46613,P01582,P01583,P08831,P16598,P48089,Q28385
    Additional SwissProt Accessions: Q28385,P01582,P16598,P08831,P01583,O46612,O46613,P48089
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease cancer, Sarcoidosis, ovarian cancer, Urinary bladder urothelial carcinoma
    Disease from KEGG MAPK signaling pathway, Cytokine-cytokine receptor interaction, Cellular senescence, Osteoclast differentiation, Hematopoietic cell lineage, AGE-RAGE signaling pathway in diabetic complications, Type I diabetes mellitus, Alzheimer disease, Pertussis, Leishmaniasis, Tuberculosis, Measles, Influenza A, Inflammatory bowel disease, Rheumatoid arthritis, Graft-versus-host disease, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSECAG00000023727, ENSMUSG00000027399, ENSG00000115008, ENSCAFG00845011308, ENSMMUG00000052787
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.