Human WNT9A/WNT14 ORF/cDNA clone-Adenovirus plasmid (NM_003395.4)

Cat. No.: pGMAD001279
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT9A/WNT14 adenoviral expression plasmid for WNT9A adenovirus packaging, WNT9A adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to WNT9A/WNT14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD001279
Gene Name WNT9A
Accession Number NM_003395.4
Gene ID 7483
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1098 bp
Gene Alias WNT14
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGCTGGATGGGTCCCCGCTGGCGCGCTGGCTGGCCGCGGCCTTCGGGCTGACGCTGCTGCTCGCCGCGCTGCGCCCTTCGGCCGCCTACTTCGGGCTGACGGGCAGCGAGCCCCTGACCATCCTCCCGCTGACCCTGGAGCCAGAGGCGGCTGCCCAGGCGCACTACAAGGCCTGCGACCGGCTGAAGCTGGAGCGGAAGCAGCGGCGCATGTGCCGCCGGGACCCGGGCGTGGCAGAGACGCTGGTGGAGGCCGTGAGCATGAGTGCGCTCGAGTGCCAGTTCCAGTTCCGCTTTGAGCGCTGGAACTGCACGCTGGAGGGCCGCTACCGGGCCAGCCTGCTCAAGCGAGGCTTCAAGGAGACTGCCTTCCTCTATGCCATCTCCTCGGCTGGCCTGACGCACGCACTGGCCAAGGCGTGCAGCGCGGGCCGCATGGAGCGCTGTACCTGCGATGAGGCACCCGACCTGGAGAACCGTGAGGCCTGGCAGTGGGGGGGCTGCGGAGACAACCTTAAGTACAGCAGCAAGTTCGTCAAGGAATTCCTGGGCAGACGGTCAAGCAAGGATCTGCGAGCCCGTGTGGACTTCCACAACAACCTCGTGGGTGTGAAGGTGATCAAGGCTGGGGTGGAGACCACCTGCAAGTGCCACGGCGTGTCAGGCTCATGCACGGTGCGGACCTGCTGGCGGCAGTTGGCGCCTTTCCATGAGGTGGGCAAGCATCTGAAGCACAAGTATGAGACGGCACTCAAGGTGGGCAGCACCACCAATGAAGCTGCCGGCGAGGCAGGTGCCATCTCCCCACCACGGGGCCGTGCCTCGGGGGCAGGTGGCAGCGACCCGCTGCCCCGCACTCCAGAGCTGGTGCACCTGGATGACTCGCCTAGCTTCTGCCTGGCTGGCCGCTTCTCCCCGGGCACCGCTGGCCGTAGGTGCCACCGTGAGAAGAACTGCGAGAGCATCTGCTGTGGCCGCGGCCATAACACACAGAGCCGGGTGGTGACAAGGCCCTGCCAGTGCCAGGTGCGTTGGTGCTGCTATGTGGAGTGCAGGCAGTGCACGCAGCGTGAGGAGGTCTACACCTGCAAGGGCTGA
ORF Protein Sequence MLDGSPLARWLAAAFGLTLLLAALRPSAAYFGLTGSEPLTILPLTLEPEAAAQAHYKACDRLKLERKQRRMCRRDPGVAETLVEAVSMSALECQFQFRFERWNCTLEGRYRASLLKRGFKETAFLYAISSAGLTHALAKACSAGRMERCTCDEAPDLENREAWQWGGCGDNLKYSSKFVKEFLGRRSSKDLRARVDFHNNLVGVKVIKAGVETTCKCHGVSGSCTVRTCWRQLAPFHEVGKHLKHKYETALKVGSTTNEAAGEAGAISPPRGRASGAGGSDPLPRTPELVHLDDSPSFCLAGRFSPGTAGRRCHREKNCESICCGRGHNTQSRVVTRPCQCQVRWCCYVECRQCTQREEVYTCKG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0559-Ab Anti-WNT9A/ WNT14 functional antibody
    Target Antigen GM-Tg-g-SE0559-Ag WNT9A protein
    Cytokine cks-Tg-g-GM-SE0559 wingless-type MMTV integration site family, member 9A (WNT9A) protein & antibody
    ORF Viral Vector pGMLP005579 Human WNT9A Lentivirus plasmid
    ORF Viral Vector pGMAD001279 Human WNT9A Adenovirus plasmid
    ORF Viral Vector pGMPC001795 Human WNT9A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005579 Human WNT9A Lentivirus particle
    ORF Viral Vector vGMAD001279 Human WNT9A Adenovirus particle


    Target information

    Target ID GM-SE0559
    Target Name WNT9A
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7483
    Gene ID 100061110 (Equus caballus), 111560436 (Felis catus), 216795 (Mus musculus), 287357 (Rattus norvegicus)
    482209 (Canis lupus familiaris), 511308 (Bos taurus), 696326 (Macaca mulatta), 7483 (Homo sapiens)
    Gene Symbols & Synonyms WNT9A,Wnt9a,Wnt14,wnt-14,WNT14
    Target Alternative Names Protein Wnt-14,Protein Wnt-9a,WNT14,WNT9A,Wnt14,Wnt9a,wnt-14
    Uniprot Accession O14904,Q8R5M2
    Additional SwissProt Accessions: Q8R5M2,O14904
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease
    Disease from KEGG Wnt signaling pathway, Hippo signaling pathway, Signaling pathways regulating pluripotency of stem cells, Melanogenesis, Cushing syndrome, Alzheimer disease, Human papillomavirus infection, Pathways in cancer, Proteoglycans in cancer, Basal cell carcinoma, Breast cancer, Hepatocellular carcinoma, Gastric cancer
    Gene Ensembl ENSECAG00000020178, ENSMUSG00000000126, ENSBTAG00000020267, ENSMMUG00000008338, ENSG00000143816
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.