Human CXCL8/GCP-1/GCP1 ORF/cDNA clone-Adenovirus plasmid (NM_000584)
Cat. No.: pGMAD000710
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CXCL8/GCP-1/GCP1 adenoviral expression plasmid for CXCL8 adenovirus packaging, CXCL8 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
CXCL8/IL-8/IL8/CXCL8/GCP-1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAD000710 |
Gene Name | CXCL8 |
Accession Number | NM_000584 |
Gene ID | 3576 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 300 bp |
Gene Alias | GCP-1,GCP1,IL8,LECT,LUCT,LYNAP,MDNCF,MONAP,NAF,NAP-1,NAP1,SCYB8 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGTGAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA |
ORF Protein Sequence | MTSKLAVALLAAFLISAALCEGAVLPRSAKELRCQCIKTYSKPFHPKFIKELRVIESGPHCANTEIIVKLSDGRELCLDPKENWVQRVVEKFLKRAENS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T22658-Ab | Anti-IL8/ CXCL8/ GCP-1 functional antibody |
Target Antigen | GM-Tg-g-T22658-Ag | IL8/CXCL8 protein |
Cytokine | cks-Tg-g-GM-T22658 | interleukin 8 (IL8) protein & antibody |
ORF Viral Vector | pGMLV000447 | Human CXCL8 Lentivirus plasmid |
ORF Viral Vector | pGMLV000943 | Human CXCL8 Lentivirus plasmid |
ORF Viral Vector | pGMLV001490 | Human CXCL8 Lentivirus plasmid |
ORF Viral Vector | pGMAD000710 | Human CXCL8 Adenovirus plasmid |
ORF Viral Vector | pGMAP000556 | Human IL8 Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-011 | Human CXCL8 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-094 | Human CXCL8 Adenovirus plasmid |
ORF Viral Vector | vGMLV000447 | Human CXCL8 Lentivirus particle |
ORF Viral Vector | vGMLV000943 | Human CXCL8 Lentivirus particle |
ORF Viral Vector | vGMLV001490 | Human CXCL8 Lentivirus particle |
ORF Viral Vector | vGMAD000710 | Human CXCL8 Adenovirus particle |
ORF Viral Vector | vGMAP000556 | Human IL8 Adenovirus particle |
ORF Viral Vector | vGMLP-IL-011 | Human CXCL8 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-094 | Human CXCL8 Adenovirus particle |
Target information
Target ID | GM-T22658 |
Target Name | CXCL8/IL-8/IL8 |
Gene Group Identifier (Target Gene ID in Homo species) |
3576 |
Gene ID |
100037400 (Equus caballus), 280828 (Bos taurus), 3576 (Homo sapiens), 403850 (Canis lupus familiaris) 613028 (Macaca mulatta) |
Gene Symbols & Synonyms | CXCL8,IL8,IL-8,NAF,GCP1,LECT,LUCT,NAP1,GCP-1,LYNAP,MDNCF,MONAP,NAP-1,SCYB8 |
Target Alternative Names | C-X-C motif chemokine 8,CXCL8,Chemokine (C-X-C motif) ligand 8,Emoctakin,GCP-1,GCP1,Granulocyte chemotactic protein 1 (GCP-1),IL-8,IL8,Interleukin-8,LECT,LUCT,LYNAP,MDNCF,MONAP,Monocyte-derived neutrophil chemotactic factor (MDNCF),Monocyte-derived neutrophil-activating peptide (MONAP),NAF,NAP-1,NAP1,Neutrophil-activating protein 1 (NAP-1),Protein 3-10C,SCYB8,T-cell chemotactic factor |
Uniprot Accession |
O62812,P10145,P41324,P67813,P79255
Additional SwissProt Accessions: O62812,P79255,P10145,P41324,P67813 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | |
Disease from KEGG | Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway, NF-kappa B signaling pathway, Phospholipase D signaling pathway, Cellular senescence, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, IL-17 signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Alcoholic liver disease, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pertussis, Legionellosis, Yersinia infection, Chagas disease, Malaria, Amoebiasis, Hepatitis B, Human cytomegalovirus infection, Influenza A, Kaposi sarcoma-associated herpesvirus infection, Pathways in cancer, Bladder cancer, Rheumatoid arthritis, Lipid and atherosclerosis |
Gene Ensembl | ENSECAG00000015342, ENSBTAG00000019716, ENSG00000169429, ENSMMUG00000060156 |
Target Classification | Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.