Human LGALS1/GAL1/GBP ORF/cDNA clone-Adenovirus plasmid (NM_002305)

Cat. No.: pGMAD000545
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LGALS1/GAL1/GBP adenoviral expression plasmid for LGALS1 adenovirus packaging, LGALS1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Galectin-1/LGALS1/LGALS1/GAL1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000545
Gene Name LGALS1
Accession Number NM_002305
Gene ID 3956
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 408 bp
Gene Alias GAL1,GBP
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA
ORF Protein Sequence MACGLVASNLNLKPGECLRVRGEVAPDAKSFVLNLGKDSNNLCLHFNPRFNAHGDANTIVCNSKDGGAWGTEQREAVFPFQPGSVAEVCITFDQANLTVKLPDGYEFKFPNRLNLEAINYMAADGDFKIKCVAFD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T09544-Ab Anti-LEG1/ LGALS1/ GAL1 functional antibody
    Target Antigen GM-Tg-g-T09544-Ag LGALS1 protein
    ORF Viral Vector pGMLP001964 Human LGALS1 Lentivirus plasmid
    ORF Viral Vector pGMAD000545 Human LGALS1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000234 Human LGALS1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000003 Human LGALS1 Adenovirus plasmid
    ORF Viral Vector vGMLP001964 Human LGALS1 Lentivirus particle
    ORF Viral Vector vGMAD000545 Human LGALS1 Adenovirus particle
    ORF Viral Vector vGMAAV000234 Human LGALS1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000003 Human LGALS1 Adenovirus particle


    Target information

    Target ID GM-T09544
    Target Name Galectin-1/LGALS1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3956
    Gene ID 100069841 (Equus caballus), 101098151 (Felis catus), 16852 (Mus musculus), 326598 (Bos taurus)
    3956 (Homo sapiens), 56646 (Rattus norvegicus), 610276 (Canis lupus familiaris)
    Gene Symbols & Synonyms LGALS1,Lgals1,galectin-1,L14,Gal-1,Galbp,L-14.5,Lect14,GBP,GAL1
    Target Alternative Names 14 kDa laminin-binding protein (HLBP14),14 kDa lectin,Beta-galactoside-binding lectin L-14-I,GAL1,GBP,Gal-1,Galaptin,Galbp,Galectin-1,HBL,HPL,L-14.5,L14,LGALS1,Lactose-binding lectin 1,Lect14,Lectin galactoside-binding soluble 1,Lgals1,Putative MAPK-activating protein PM12,S-Lac lectin 1,galectin-1
    Uniprot Accession P09382,P11116,P11762,P16045
    Additional SwissProt Accessions: P16045,P11116,P09382,P11762
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target
    Disease cancer, Congenital occlusion of ureteropelvic junction
    Disease from KEGG
    Gene Ensembl ENSECAG00000006745, ENSMUSG00000068220, ENSBTAG00000015089, ENSG00000100097, ENSCAFG00845005881
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.